UFH Research Report 20212022

Univ er sit y of F or t Har University of Fort Hare e | RESEARCH REPOR RESEARCH REPORT T 20 2021/2022 21/20 22 www.ufh.ac.zaufh1916@ufh1916 @ufh1916 Towards a Decade of Renewal Research Report 2021/2022 | 1

Foreword Professor Sakhela Buhlungu, Vice Chancellor and Principal As the University of Fort Hare at the start of this year began implementing its 2022-2026 Strategic Plan focused on institutional renewal, it is important to showcase our recent research. Given the UFH’s unique location and specific context, we aim to produce research that is both locally responsive and globally relevant and impactful. For the period 2021-2022, we have achieved excellence in several research areas as well as in the financial and administrative management of our institutional resources that support research endeavours. Our aim is to create an enabling environment for our researchers, and to cultivate an institutional culture that nurtures young researchers and values the quality and depth of our research output. As I write to you, 39 academics have received NRF-ratings, demonstrating a solid upward trajectory. This achievement goes a long way towards positioning UFH as a research-focused university that has a strong and visible footprint regionally, nationally and internationally. We have also been working on building, formalising and strengthening our Research Niche Areas (RNAs). In addition, significant shifts have taken place in terms of support for researchers and the establishment of a proper research office. Following the formal approval of the Research Rewards Policy and the SOPs for operationalizing the policy, research cost centres were created 1 | University of Fort Hare

The University is indeed making significant strides towards achieving its vision of becoming ’a distinctive African university, advancing excellence and innovation in research, teaching, learning, administration, and social engagement‘ for 289 researchers who were due conditions in order to continue ranking. Earlier this year, UFH also to receive research incentive funds conducting research. Moreover, our performed well in the Scimago emanating from DHET-approved UFH researchers turned the lens Institutions (SI) Rankings, where, in research outputs for 2020. The on the Covid-19 pandemic itself, the overall ranking for South African created research cost centres allow and investigated the consequences higher education institutions – which funds to roll over indefinitely in order thereof and shifts it produced, so that considered research, societal impact to enable researchers to build up it became a research area in its own and innovation – UFH was clustered their research funds until they have right. in the second quartile. In terms enough funds available to carry out None of these achievements would of South African universities, the their research activities. have been possible without our UFH University of Fort Hare was placed researchers, postdoctoral fellows, in the 12th position with 23 South The University also received African institutions listed. There are, an unqualified audit for Grant postgraduate students, research and of course, many university ranking Management from the National finance support staff, funders, donors indexes available, and the UFH does Research Foundation’s auditors in and the communities that we engage not participate in all rankings or August 2022. The audit highlighted with within the province and beyond. perform equally well in all of these. We that findings identified in previous The University is indeed making are therefore focused on doing the audit cycles from 2016 had been significant strides towards achieving right things at the University, in the addressed effectively, and the 2022 its vision of becoming ’a distinctive knowledge that this will also reflect audit tests performed showed that African university, advancing the UFH Research and Innovation excellence and innovation in research, in the University’s position on ranking Office now fully complies with NRF teaching, learning, administration, indexes, without placing undue focus grant conditions and the Master Fund and social engagement‘. on chasing rankings. Doing the right Administration Agreement. The audit things means, in the first instance, verified the accuracy and validity of Whilst our UFH 2021-2022 Research investing in our researchers, inducting transactions and compliance with Report showcases only some of our our students in research methods pertinent UFH policies that include outstanding research projects, it does early on in their training, and, perhaps procurement and travel policies. not cover all our research activities. most importantly, encouraging and Independent external auditors also I have no doubt, however, that the rewarding the kind of intellectual reported zero findings in 2022, glimpse it provides of the diverse curiosity and tenacity that produce corroborating the findings of the NRF range of research and the innovative truly extraordinary research. audit. thinking underpinning these research projects demonstrates that research Although our research activities since is the cornerstone of our renewal early 2020 were negatively affected programme. by the Covid-19 pandemic and the Recently, the University of Fort Hare related lockdowns, which hindered was ranked on the prestigious Times fieldwork and data collection, our Higher Education World University researchers demonstrated resilience Rankings, one of only fifteen South and adaptability. This enabled African universities to receive a them to navigate the restrictive Research Report 2021/2022 | 2

3 | University of Fort Hare

Introduction Dr Nthabi Taole-Mjimba, Deputy Vice-Chancellor: Research, Partnerships and Innovation The University of Fort Hare’s (UFH) 2021-2022 Research Report provides a succinct but comprehensive overview of some of the excellent research activities conducted by our researchers, postdoctoral fellows and postgraduate students. It is not possible to cover all the activities of researchers at the University in a single annual report. What is presented here is therefore but a sample of our research strengths and achievements. The report showcases research conducted in a number of knowledge areas including the Science and Agriculture, the Health Sciences, Law and Management and Commerce. It also highlights work done on renewable energy, a focus area with the potential to benefit all humankind regardless of their location in the world. At UFH recognition of excellence in research is achieved by means of the Vice Chancellor’s awards for emerging researchers and established researchers. Awards are made to an overall winner in each category as well as to winners at faculty level. In order to foster innovation, two additional awards have been introduced: an award for the development of the most innovative prototype and another for the most novel pre-commercialization product, service or process developed by institutional researchers. Partnerships with other universities are important in enhancing the standing of the University at regional, national and international levels. Partnerships exist with institutions in Africa, Europe, Asia, South America and North America and are evidence of the extent to which collaboration with us is valued. This report provides but a glimpse of some of the research activities that strengthened our research and innovation profile and our ranking. I hope you will enjoy reading about the work of our researchers and what they have achieved. Research Report 2021/2022 | 4

Contents 1 | University of Fort Hare at a glance ...............................................................................................7 2 | Natural and Agricultural Sciences ................................................................................................9 Smart energy systems and sustainable development studies at the Fort Hare Institute of Technology .................................................................................................................................................................11 Helping farmers to adapt to climate change ......................................................................................................13 Vulnerability and flooding: Paving the way for South Africa to deal with climate change .......................15 Reducing goat kid mortality: Another UFH project benefits local communities ........................................17 UFH team takes us a step forward in addressing antibiotic resistance ......................................................19 Synthesis of silica nanoparticles doped with zinc cation for the removal of bacteria DNA harboring antibiotic resistance genes from aqueous solution ......................................................................21 Making choices for the future: UFH research informs thinking about the feasibility of rooftop solar systems...............................................................................................................................................25 3 | Health Sciences .............................................................................................................................27 Identifying misconceptions about tuberculosis: A step forward in developing effective awareness campaigns ..............................................................................................................................................29 The link between crime and mental health in South Africa ............................................................................31 Making a difference in the health of local communities: The work of the HIV/ AIDS Research Group ...........................................................................................................................................................................33 Learning from African Traditional Medicine: Fort Hare researcher leads the way ...................................35 Keeping active: promoting the benefits of physical activity and exercise for pregnant women ...........37 Promoting exercise and healthy eating amongst farmers ..............................................................................39 5 | University of Fort Hare

4 | Management and Commerce ......................................................................................................41 Using technology in teaching and learning: Important insights from Fort Hare study ............................43 Forging partnerships for excellence - The role of the African University ....................................................45 Improving service delivery through e-government ...........................................................................................47 Pandemics and infodemics: the importance of providing trustworthy information ................................49 An alternative to the universities? Investigating service quality at TVET Colleges .....................................51 UFH-based accredited journal contributes to renewal of local government .............................................53 5 | Legal Issues ....................................................................................................................................55 Free trade and the human right to food: The need to re-theorise and review international agricultural trade regulation ...................................................................................................................................57 The role of the judiciary in achieving the goals of the 2030 Agenda for Sustainable Development in South Africa ..................................................................................................................................59 Two heads are better than one: Assessing South Africa’s ‘twin-peaks’ financial regulation model ......61 Company law and investor confidence: Analysing Zimbabwe’s new Companies and Other Business Entities Act .................................................................................................................................................63 Getting to school and the right to basic education ..........................................................................................65 6 | Vice Chancellor’s Research Awards ............................................................................................67 VC’s Senior Researcher Awards .............................................................................................................................69 VC’s Emerging Researcher Awards .......................................................................................................................72 VC’s Innovation Awards ............................................................................................................................................74 VC’s Awards for Newly NRF-rated Researchers .................................................................................................75 Acknowledgements ............................................................................................................................79 Research Report 2021/2022 | 6

University of Fort Hare at a glance B3 Faculty/ NRF-Rating Total Y2 Research Centre B3 C1 C2 C3 Y2 C1 Science & Agriculture 1 3 8 6 3 21 39 Law 1 1 1 3 Health Sciences 1 1 2 NRF Rated Social Sciences 1 3 2 1 7 Researchers Management & 2 2 4 C3 Commerce C2 Centre for Leadership 1 1 2 Ethics in Africa (CLEA) Total 2 7 11 12 7 39 85,63% 52,63% South South 2022 Graduation African 160 African 57 (2021 Academic year) masters doctoral graduates graduates 14,37% 47,37% foreign foreign 7 | University of Fort Hare

2022 Masters Students Registrations Masters registrations according to faculty and nationality (2022) Education Health Sciences Law Management & Commerce Science & Agriculture Social Sciences & Humanities 0 50 100 150 200 250 South African Foreign 93,2% 868 6,8 % female 55,3% male South masters foreign female African students students 2022 Doctoral Registrations Doctoral registrations according to faculty and nationality (2022) Education Healthth Sc Sciieenncceses Law Management & Commerce Science & Agriculture Social Sciences & Humanities 0 20 40 60 80 100 120 140 South African Foreign 69,84% 451 30,16% female 51,22% male South doctoral foreign female African students students Research Report 2021/2022 | 8

9 | University of Fort Hare

Natural and Agricultural Sciences Research Report 2021/2022 | 10

NATURAL AND AGRICULTURAL SCIENCES Smart energy systems and sustainable development studies at the Fort Hare Institute of Technology Professor Edson L. Meyer Global warming and the climate change associated with it mean that ensuring our planet remains habitable for generations in the future is enormously important. Thankfully, scientists at the Fort Hare Institute of Technology under the leadership of Director Professor Edson L. Meyer have been working to achieve this very goal thanks to research focused on solar energy technology, bio energy engineering, smart energy systems and sustainable development. Professor Edson L. Meyer hotovoltaic (PV) systems that installed are sometimes made worse solar power means that areas that convert power from the sun by defects in their manufacture. would otherwise have been available into clean, sustainable, cheap Researchers at the UFH Institute of to grow crops are reduced. In addition, P energy are increasing in popularity, Technology, located in SolarWatt large-scale solar generation projects with houses, shopping complexes Park on the Alice Campus, are now do not often involve participation from and other buildings now sporting conducting studies which aim to communities in the area or result in the panels that make this possible detect and classify defects in PV job opportunities once the systems on their rooftops. Often, these systems and which also identify the have been installed. However, using systems have to endure extreme way in which they degrade. land for both PV power generation environmental conditions which In South Africa, the potential of and agriculture has the potential to contribute to their ageing rate and photovoltaics (PV) as a renewable change all this, and this has resulted deterioration. Problems resulting technology has resulted in the large- in UFH scientists becoming interested from harsh conditions in the outdoor scale usage of land to harvest solar in ‘agrovoltaic’ projects. environments in which they are energy. The use of land to generate Studies on agrovoltaic projects show 11 | University of Fort Hare

NATURAL AND AGRICULTURAL SCIENCES Figure 1: Daylighting assessment of a heritage building using CBDM that plants utilise about two-thirds of The evolution in lighting technology illuminance data in weather files to the daily solar radiation in a system has meant that the old-fashioned do this. Analysis using the Climate- and that yield from crops grown light bulbs and fluorescent tubes Based Daylight Model (CBDM) made underneath the photovoltaic modules of the past have been replaced by it possible to assess the impact of increases. If agrovoltaic systems are innovations such as Light Emitting daylighting on energy-use intensity introduced, land efficiency can be Diodes (LEDs) and incandescent and thermal behaviour in the increased by up to 186%. In addition, and magnetic ballast fluorescent building. The study showed that using workers from local communities fittings. These have reduced the automated on/off sensors would can become involved in agricultural amount of electricity needed to reduce annual lighting energy savings production, and communities benefit provide light in buildings. In spite of by 52% while continuous dimming from job creation. If drip irrigation these developments, daylight is still would result in energy savings of 64%. and agroponic systems are also the only free, zero-energy and zero- The study also showed that lighting introduced, water is conserved carbon light source. In addition to energy costs would be reduced by 50% and a further step is taken towards these benefits, studies have shown by using on/off sensors and by 62% by sustainability. Regenerative farming that daylighting improves well- using continuous dimming sensors. methods using minimum fertiliser being, health, and productivity in the Importantly, CO2 emissions due to can then result in the increased workplace. annual lighting energy consumption retention of water in the soil. When Researchers at the UFH Institute of in this building were mitigated by agrovoltaic systems are established in Technology are exploring the use 52% and 64% using automated on/ urban areas in the form of inner-city of daylighting in residential and off and continuous dimming sensors, gardening, the temperatures in ‘heat commercial buildings in the context respectively. These examples of some islands’ are reduced. All this means of the need to conserve energy. One of the studies conducted by the UFH that the promise of renewable energy study has involved research on the Institute of Technology show how and an increase in the availability daylight performance of Livingstone UFH researchers are contributing of food resulting from agrovoltaic Hall on the Alice campus. to sustainable futures in meaningful projects underlines the importance of ways. the research being done in the UFH The study drew on sky conditions and Institute of Technology. models based on solar irradiance and Research Report 2021/2022 | 12

NATURAL AND AGRICULTURAL SCIENCES Helping farmers to adapt to climate change Martin Chari and Dr Leocadia Zhou problems and other challenges that Fortunately, remote sensing, a continue to threaten resource-poor technique that involves detecting communities. energy that is reflected from the earth, Predictions are that global warming provides a means of overcoming will result in some areas being these limitations. The research team more susceptible to flooding, while therefore embarked on a study that others are expected to suffer from aimed to identify what needed to be unpredictable failures in rainfall. done to ensure that remote sensing Although farmers may try to adapt could used more fully by the small- to changing rainfall patterns by scale farmers whose lives it could shifting from the production of food benefit. crops to rearing livestock, this is The study was based on a review not necessarily a positive solution of articles in the Web of Science as a rise in livestock numbers publications between 1999 and 2019. will lead to an escalation in the Overall, the team identified 1,337 production of green-house gases articles focusing on soil moisture, and a consequent increase in global 172 of which finally emerged as warming. peer-reviewed articles that used One way of addressing changes techniques to estimate soil moisture in rainfall patterns is to provide which then led to the use of strategies farmers with usable information intended to cope with climate change. on how to overcome a reduction In accounting for the marginal Dr Leocadia Zhou use of remote sensing techniques in the amount of moisture in in the papers they reviewed, the lleviating the impact of global soil by adopting climate-friendly researchers concluded that this was warming and climate change is farming practices. However, doing because most African countries have Athe focus of a study conducted this requires information about soil limited access to appropriately scaled by doctoral candidate Martin Chari, moisture at levels of spatial detail images. This then led the team to under the supervision of Professor that meet the needs of farmers argue that the best way forward is to Hamisai Hamandawana of the themselves. Although the literature formulate techniques that use freely University of the Free State’s Risk and offers information on a wide range accessible coarse resolution images Vulnerability Science Centre (RVSC) of techniques used to estimate to provide much needed information. and Dr Leocadia Zhou of the RSCV soil moisture, most are difficult to at the University of Fort Hare. The implement because they rely on high- The contribution made by Martin study aims to support farmers whose resolution datasets most developing Chari and his supervisors is valuable livelihoods are largely dependent on countries cannot afford, are labour because it shows what needs to be rain-fed agriculture and demonstrates intensive and time consuming, and done in order to enhance the ability the willingness and commitment are also incapable of providing the of farmers to adapt to changes in soil of UFH researchers to address information at a level that is usable by moisture driven by climate change. pressing climate-change related small-scale farmers. 13 | University of Fort Hare

NATURAL AND AGRICULTURAL SCIENCES Reference: Chari, M.M., Hamandawana, H., Zhou, L. 2022. ‘Integrating Remotely Sensed Soil Moisture in Assessing the Effects of Climate Change on Food Production: A Review of Applications in Crop Production in Africa.’ In: Leal Filho, W., Djekic, I., Smetana, S., Kovaleva, M. (eds) Handbook of Climate Change Across the Food Supply Chain. Climate Change Management. Springer, Cham. https://doi.org/10.1007/978-3-030-87934-1_12 14 | University of Fort Hare

NATURAL AND AGRICULTURAL SCIENCES Vulnerability and flooding: Paving the way for South Africa to deal with climate change One of the most common predictions made in earning from past flooding events relation to global warming is that, regardless of the in order to plan for the future is country in which we live, we will experience extreme Ltherefore hugely important, a point not missed by a team of researchers weather events, such as increased flooding. In a comprising Dr Saul Ngarava and Dr country such as South Africa, where large numbers Leocardia Zhou from the Risk and of people live in informal settlements and insecure Vulnerability Science Centre (RVSC) at the University of Fort Hare (UFH) and housing, floods have the potential to cause Professor Abbyssinia Mushuje from the enormous suffering. University’s Department of Economics. The team also included Dr Petronella Chaminuka from the Economic Analysis Unit at the Agricultural Research Council, testimony to the ability of Fort Hare researchers to network and collaborate with colleagues working in research councils and other entities external to the universities. A recent flooding event in Port St Johns in April 2019, when 190mm of rain fell in 24 hours, devastated local communities. Extraordinarily high rainfall coupled with high oceanic tides that pushed the Mzimvubu River water back upstream caused the river to burst its banks resulting in low lying settlements being cut off and hundreds of residents having to be evacuated. The research team therefore put their skills and knowledge to use and designed a semi-structured questionnaire that was administered to 195 residents in the area in order to determine the exposure, susceptibility and Floods in Durban 2022 resilience of communities to flooding. 15 | University of Fort Hare

NATURAL AND AGRICULTURAL SCIENCES Floods in Durban 2022 A multiplicative method drawing on levels, and a lack of alternative forms of Reference: these indicators was then used to livelihood, residing on slopes and flood Ngarava, S., Zhou, L., Mushunje, develop a Flood Vulnerability Index prone areas meant that communities A., Chaminuka, P. (2021). (FVI). were vulnerable economically and Vulnerability of Settlements to As a result of their research, the team environmentally. Floods in South Africa: A Focus found that, because of its topography, In April 2022, floods in Durban resulted on Port St Johns. In: Nhamo, Port St Johns was particularly in more than 300 people losing G., Chapungu, L. (eds) The vulnerable to the impact of floods. their lives and once again showed Increasing Risk of Floods and People living in informal settlements how vulnerable many South African Tornadoes in Southern Africa. were most likely to be physically and communities are to flooding and Sustainable Development socially vulnerable because of blocked affirmed the work of the UFH team, Goals Series. Springer, Cham. drainage systems, impermanent, which has now appeared as a chapter https://0-doi.org.wam. in a book published by international poorly designed and badly sealsac.za/10.1007/978-3-030- constructed shelters, a lack of storm publisher Springer. The chapter paves 74192-1_12 water infrastructure, overcrowding the way for more research of this and high levels of poverty. In rural nature if South Africa is to prepare settlements characterised by high itself for the future. levels of unemployment, low-income Research Report 2021/2022 | 16

NATURAL AND AGRICULTURAL SCIENCES Reducing goat kid mortality: Another UFH project benefits local communities Dr M. Slayi, Dr Leocadia Zhou, Dr Thobela Tyasi and Dr Ishmael Jaja he commitment of researchers to find ways of improving the from the University of Fort Hare survival rates of kids. Interventions to use their knowledge for the included fortnightly dipping to control T benefit of local communities was parasites, supplying food to pregnant demonstrated once again in a project and lactating does, providing shelters led by Dr Mhlangabezi Slayi of the and improving hygiene. Traditionally, Risk and Vulnerability Science Centre community members had relied (RVSC) in the Faculty of Science and on indigenous remedies to cure Agriculture. sickness. The project made veterinary Goats are owned by many small-scale assistance and medication available farmers in South Africa, with more when needed. than 50% of the total goat population In the first year of the project, 132 of the country being raised in rural of the 235 (56.17%) kids born in the areas of the Eastern Cape. For many villages studied died. By year two, families, rearing goats provides however, the impact of the project enormous socio-economic benefits, was such that the mortality rate was so high mortality rates amongst kid reduced to 22.38%, with only 62 of goats prevent them from optimising the 277 kids born in the year dying. what should be a major source of The reduction in the mortality rate income and well-being. was particularly significant in kids The two-year project led by Dr aged younger than 45 days. Slayi aimed not only to confirm the In their paper published in the identification of the major causes of prestigious international journal, goat mortality in community flocks Tropical Animal Health and (identified by farmers themselves in a Production, Dr Slayi and fellow team project conducted in 2014), but also members Dr Leocadia Zhou, Dr to work with community members Thobela Tyasi and Dr Ishmael Jaja 17 | University of Fort Hare

NATURAL AND AGRICULTURAL SCIENCES identify the project as having enjoyed Support from the government and Reference: ‘moderate success’ in reducing kid private research institutions for Slayi, M., Zhou, L., Tyasi, T.L. & mortality. Outsiders would probably the establishment and facilitation Jaja, I. 2022. ‘A community based consider the success as more than of control programmes, as well as intervention approach to control moderate, however, especially as the for the funding of research on the disease outbreaks and climate project also provided major insights effects of disease and climate on goat related deaths in communally into the impact of major diseases production, is inadequate. However, raised goat kids in the Eastern Cape and climate related events on goat Fort Hare researchers have once Province, South Africa.’ Tropical production, which will serve both again shown how scholarship and Animal Health and Production, researchers and farmers into the commitment can be of benefit to local 54: 140 https://doi.org/10.1007/ future. communities as well as to science s11250-022-03143-5 more generally. Research Report 2021/2022 | 18

NATURAL AND AGRICULTURAL SCIENCES UFH team takes us a step forward in addressing antibiotic resistance Adaora Ezeuko and Eric Anthony he introduction of penicillin in had the potential to become much people admitted for treatment, who the 1940s heralded a new era greater threats to health and life then have to contend with a life- of medical practice. Doctors was greatly increased. However, for threatening bacterial infection as well T and healers had battled bacterial years now, scientists and doctors as the original disease, and, of course, infections for centuries, and the have been warning about the abuse we are all aware of drug resistant discovery of an antibiotic that would of antibiotics and the development of TB because of its effect on many kill bacteria meant surgery suddenly drug resistant strains of bacteria that members of our own communities. became safer, the chances of healing threaten human lives. Scientists have been able to identify from injuries became stronger, and So-called ‘superbugs’ in hospitals the genes that are implicated in the ability to combat simple ailments can have devastating effects on resistance to antibiotics for some time like sore throats and bronchitis that 19 | University of Fort Hare

NATURAL AND AGRICULTURAL SCIENCES now. Water is one of the main routes also a member of the Microbial Water the resulting compound was used in by which antibiotic resistant genes Quality Monitoring Centre. Professor an experiment aimed at the removal (ARGs) are spread, and freshwater, Omobola Okoh is a Lecturer in the of an antibiotic-resistant bacterium surface water, drinking water and Department of Pure and Applied named Listeria monocytogene. wastewater have all been identified Chemistry and is linked to the Previous testing had shown that as carrying them. Of all these, Microbial Water Quality Monitoring Listeria monocytogene was resistant wastewater is a particular ‘hotspot’, Centre while Professor Anthony Okoh to sulfamethoxazole, erythromycin, and the quest is on to combat the is a lecturer in the Department of streptomycin, amoxicillin, and proliferation and spread of ARGs in Biochemistry and Microbiology and tetracycline, antibiotics often used this particular water source. is also linked with the Department by doctors as the first line of defence Adsorption technology is one method of Environmental Health Sciences in against infection. Through painstaking that has been identified as having the College of Health Sciences at the and rigorous research, the UFH the potential to combat ARGs in University of Sharjah in the United research team was able to show that wastewater. Its cost effectiveness Arab Emirates. Professor Okoh is also the mesoporous silica nanoparticles a member of the Microbial Water is just one of the reasons why the doped with zinc cation (SiO @Zn2+) Quality Monitoring Centre at UFH. 2 technique attracted the attention of were effective in removing bacterial a team of prestigious and emerging The attention of the research team DNA conveying antibiotic resistance scientists from the University of was drawn to the use of metallic genes from water. The team went Fort Hare (UFH). Emerging scientists oxides in adsorption technology. further than this broad observation, Adaora Ezeuko and Eric Anthony are Metal oxide nanoparticles have a however, as they also explored how PhD scholars in the Department of large surface area and have been different operating parameters (such Pure and Applied Chemistry at UFH shown to be effective in removing as the time concentration profile and are also linked to the Microbial organic and inorganic pollutants and the adsorbent dose) influenced Water Quality Monitoring Centre. Both in previous studies conducted by adsorption and enhanced the doctoral candidates have conducted Professors O. Okoh, Professor removal of bacterial DNA. research on the removal of ARGs A. Okoh, and Dr Ojemaye. Zinc It is unlikely that anyone reading this from water using nanomaterials as an Oxide (ZnO) is typical of the class of article will not have needed antibiotics adsorbents. Testimony to the quality adsorbents that are very effective in in their lifetime. The idea that of the training they have received at eradicating diverse pollutants from antibiotics may not be available in the UFH is the fact that both students water/wastewater. In this latest study future to treat ailments and diseases already have three publications involving the UFH team, mesoporous to which we are all susceptible is little under their belts with Adaora Ezeuko silica nanoparticles doped with Zinc short of horrifying. However, thanks expecting a fourth imminently. Fellow cation (SiO2@Zn2+) were used. To to the work of this UFH research team member Dr Mike Ojemaye is a test this method, the team first had team, the world is a step nearer to research fellow in the Department of to develop a technique to incorporate avoiding what is feared so widely. Pure and Applied Chemistry and is zinc cation onto silica oxide before Research Report 2021/2022 | 20

NATURAL AND AGRICULTURAL SCIENCES Synthesis of silica nanoparticles doped with zinc cation for the removal of bacteria DNA harboring antibiotic resistance genes from aqueous solution 1,2 1,2 1,2 1,2 Adaora S. Ezeuko , Eric T. Anthony , Mike O. Ojemaye Omobola O. Okoh , *2 and Anthony I. Okoh . 1 Department of Pure and Applied Chemistry, University of Fort Hare, Alice 5700, South Africa. 2 SAMRC, Microbial Water Quality Monitoring Centre, University of Fort Hare, Alice, South Africa. Corresponding Author: [email protected] Abstract: This study investigated the removal of bacterial DNA from aqueous solution using silica oxide nanoparticles doped with zinc cation (SiO 2+ 2@Zn ). The authenticity of the adsorbent was confirmed by scanning electron microscopy (SEM) coupled with energy-dispersive x-ray spectroscopy (EDX). Adsorption studies involving two operating conditions (time-concentration profile and adsorbent dose) showed increased removal efficiency during the adsorption of bacterial DNA by SiO 2+ 2+ @Zn . We conclude that SiO @Zn may be a promising 2 2 adsorbent that can tackle the consequences of ARGs infected water. 1.0. Introduction The gain in the fight against bacterial infection has been short-lived due to the development and subsequent proliferation of antibiotic-resistance genes (ARGs) (Le et al., 2018). ARGs render antibiotics ineffective in the treatment of bacterial infections. Water bodies are one of the most important routes for the spread of ARGs. Thus, abundant ARGs have been detected in freshwater, surface water, drinking water, and wastewater (Zhang et al., 2009). While the presence of Professor Anthony I. Okoh naturally occurring minerals enhances the spread of ARGs in fresh and surface water, the hotspot for the enrichment of ARGs has been wastewater, incredibly wastewater rich in antibiotics (Ezeuko et al., 2021b). In the quest to combat the proliferation of ARGs in water bodies, adsorption technology has been proposed as a cost-effective technique for the removal of ARGs (Eric et al., 2021), and the application of metallic oxides has been applied for this purpose (Ezeuko et al., 2021a). In adsorption technology, the specific surface area as well as physical and chemical affinities of the adsorbent towards the adsorbate are essential criteria of an adsorbent (Song et al., 1998). Metal oxide nanoparticles possesses a large specific surface area (Chew et al., 2010) and has been used as an adsorbent to remove organic and inorganic pollutants (Ojemaye et al., 2017; Ojemaye & Okoh, 2019). ZnO is a typical adsorbent used to combat the proliferation of antibiotic-resistant bacteria-harboring ARGs due to their bacteriostatic tendencies (Eric et al., 2022). In lieu, in this study, mesoporous silica nanoparticles doped with zinc cation (SiO 2+ 2@Zn ) were synthesized via the combustion protocol and used to remove bacterial DNA harboring ARGs, free-cell DNA of Listeria monocytegene present in aqueous solution. 21 | University of Fort Hare

NATURAL AND AGRICULTURAL SCIENCES 2.0. Materials and methods 2.1. Synthesis and characterization of SiO @Zn2+ 2 2+ Incorporation of Zn cation onto SiO was achieved according to the procedure or method described in literature with 2 slight modifications (Chen et al., 2020). 2 g of cetyltrimethylammonium bromide (CTAB) and 4 mL of NaOH were dissolved o into 50 mL deionized water. The solution was stirred on the mantle for 1h at 70 C. 5 mL of tetraothorsilicate (TEOS) and nitric acid (HNO o 3) was added after a minute. The solution was further stirred for 30 minutes at 60 C. Then, 0.02 M of zinc nitrate (N O Zn.6H 0) was added in the ratio 1:1 of Zn:TEOS. All particles were further stirred for 2 h before being 2 6 2 separated and centrifuge. Then, the particles were washed three times with distilled water and dried overnight in an oven o o at 50 C. The cation-containing particles were calcined at 550 C for 18 h to remove the remaining CTAB and nitrite. The surface morphology and elemental compositions were achieved using scanning electron microscope (SEM) coupled with energy dispersive x-ray spectroscope (EDX) (JOEL JSM-6390LVSEM), respectively. 2.2. Extraction and molecular characterization of bacterial DNA The antibiotic-resistant Listeria monocytogene bacteria used in this study were obtained from our laboratory archives isolated from food and vegetables. Before the commencement of genomic DNA extraction, the bacteria isolate was subjected to an antibiotic susceptible test (Humphries et al., 2021). The extraction was carried out according to the method described in literature (Ribeiro et al., 2016). The test for antibiotic resistance genes was conducted using the primers and PCR conditions of the targeted resistance gene shown in Table 1. Table 1: Primer sequence, expected product size, and PCR protocol used for the amplification of resistance genes. Antibiotic PCR Primer sequences Product PCR protocols References Class primers size (bp) Tetracyclines tetA F: GCTACATCCTGCTTGCCTTC 210 94 °C – 5 min; 35[94 °C – 1 min; 55 °C – (Titilawo et R: CATAGATCGCCGTGAAGAGG 1 min; 72 °C 1½ min]; 72 °C – 5 min. al., 2015) 2.3. Batch adsorption study Bacterial DNA (2 mL) was used to contaminate nuclease-free water (NFW). 20 mg of SiO @Zn2+ as adsorbent was weighed 2 and added to the prepared contaminated NFW for the batch adsorption study according to the method described in literature (Ezeuko et al., 2022). Effect of contact time (0-80 mins), initial DNA concentrations (7.28 µg/mL), and adsorbent dose (10-30 mg) on DNA removal were investigated. The optimum parameters were determined and adopted during the experimentation. The percentage removal efficiency (%R) in all the solutions was calculated using Equation (1) described by (Panahi et al., 2019). Where C and C are the initial and final concentrations of DNA i f measured in µg/mL, and % R is the removal efficiency. 3.0. Result and discussion 3.1. Antibiotic susceptibility test (AST)/molecular characterization of genomic DNA The AST test showed that Listeria monocytogenes (bacteria isolates) were resistant to sulfamethoxazole, erythromycin, streptomycin, amoxicillin, and tetracycline. The determination of resistance genes was achieved by visualizing the PCR product amplifications containing genomic DNA using gel electrophoresis, indicating that bacteria isolates habors tetA resistance genes at the molecular weight of 210 bp (Figure 1) Figure 1. Gel representing tetracycline resistant gene (tetA) amplified Research Report 2021/2022 | 22

NATURAL AND AGRICULTURAL SCIENCES 3.2. Adsorbent characterization 3.2.1. SEM and EDX analysis The morphology of the adsorbent (SiO 2+ 2@Zn ) was determined using the SEM instrument captured at 20 µm. It showed that the material has an irregular shape and formed some slight aggregates (Figure 2A). The elemental composition (Figure 2B) showed strong signal for silica (Si) at 2Kev and a medium peak representing zinc (Zn) at 0.5 Kev indicating that this material is pure and its synthesis was successful. Figures 2 A and B: Represent SEM images captured at 20 µm and EDX showing the elemental compositions of SiO 2+ 2@Zn . 3.3. Bacterial DNA removal study 3.3.1. Time-concentration profile Effect of time as a function of initial DNA concentration was conducted at intervals while maintaining the adsorbent dose of 20 mg at pH 7.1. It was observed that when contact time was increased from 0 to 80 minutes, percentage adsorption efficiencies increased from 52.60-71.15% at initial DNA concentration of 7.28 µg/mL (Fig.3A) until removal became stable. This result is an indication that increase in time leads to increase in the removal of DNA from aqueous solution. The result is similar to a recently published study (Ezeuko et al., 2022). 3.3.2. Effect of adsorbent dose The adsorbent dose was studied and it is illustrated in Fig 3B. As expected, the percentage removal of bacteria DNA rapidly increased with an increase in sorbent mass from 10 to 30 mg. At 30 mg, the optimum removal efficiencies reached 81.73%. B A Figure 3A and B: Effect of A= time-concentration profile and B = adsorbent dose on the removal of bacteria DNA onto SiO @Zn2+. 2 23 | University of Fort Hare

NATURAL AND AGRICULTURAL SCIENCES 4.0. Conclusion The synthesis of SiO @Zn2+ was successfully achieved and employed for bacteria DNA removal from aqueous solution. 2 This study showed that different operating parameters (time-concentration profile, and adsorbent dose) influenced the adsorption process and enhanced the removal of bacterial DNA conveying ARG onto SiO @Zn2+ from aqueous solution. 2 Acknowledgments The authors thank the South Africa Medical Research Council for financial support. References Eric A. T, Ojemaye, M. O., Okoh, O. O., & Okoh, A. I. (2022). Le, T. H., Ng, C., Tran, N. H., Chen, H., & Gin, K. Y. H. (2018). Influence of different Ag/ZnO heterostructures on the Removal of antibiotic residues, antibiotic-resistant removal efficiency of multidrug-resistant Enterococcus bacteria, and antibiotic resistance genes in municipal faecium harboring multiple resistance genes from tap wastewater by membrane bioreactor systems. Water water. Environmental Progress & Sustainable Energy, May, Research, 145, 498–508. https://doi.org/10.1016/j. 1–11. https://doi.org/10.1002/ep.13925. watres.2018.08.060. Eric A. T, Ojemaye, M. O., Okoh, A. I., & Okoh, O. O. (2021). Ojemaye, M. O., & Okoh, A. I. (2019). Multiple nitrogens Potentials of low-cost methods for removing antibiotic- functionalized magnetic nanoparticles as an efficient resistant bacteria and their genes in low-budget adsorbent: synthesis, kinetics, isotherm, and communities: A review. Journal of Water Process Engineering, thermodynamic studies for removing rhodamine B from 40(October 2020), 101919. https://doi.org/10.1016/j. aqueous solution. Scientific Reports, 9(1), 1–13. https://doi. jwpe.2021.101919. org/10.1038/s41598-019-45293-x. Chen, S., Greasley, S. L., Ong, Z. Y., Naruphontjirakul, P., Page, Ojemaye, M. O., Okoh, O. O., & Okoh, A. I. (2017). Adsorption S. J., Hanna, J. V., Redpath, A. N., Tsigkou, O., Rankin, S., of Cu2+ from aqueous solution by a novel material, Ryan, M. P., Porter, A. E., & Jones, J. R. (2020). Biodegradable azomethine functionalized magnetic nanoparticles. zinc-containing mesoporous silica nanoparticles for Separation and Purification Technology, 183, 204–215. cancer therapy. Materials Today Advances, 6. https://doi. https://doi.org/10.1016/j.seppur.2017.02.055. org/10.1016/j.mtadv.2020.100066 Panahi, A. H., Ashrafi, S. D., Kamani, H., Khodadadi, M., Lima, Chew, T.-L., Ahmad, A. L., & Bhatia, S. (2010). Ordered E. C., Mostafapour, F. K., & Mahvi, A. H. (2019). Removal mesoporous silica (OMS) as an adsorbent and membrane of cephalexin from artificial wastewater by mesoporous to separate carbon dioxide (CO2). Advances in Colloid and silica materials using Box-Behnken response surface Interface Science, 153(1), 43–57. https://doi.org/https://doi. methodology. Desalination and Water Treatment, 159, 169– org/10.1016/j.cis.2009.12.001. 180. https://doi.org/10.5004/dwt.2019.24109. Ezeuko, A. S., Ojemaye, M. O., Okoh, O. O., & Okoh, A. I. Ribeiro, J. C., Tamanini, R., Soares, B. F., De Oliveira, A. M., De (2021a). Journal of Water Process Engineering Potentials Godoi Silva, F., Da Silva, F. F., Augusto, N. A., & Beloti, V. of metallic nanoparticles for removing antibiotic- (2016). The efficiency of boiling and four other methods for resistant bacteria and antibiotic resistance genes from genomic DNA extraction of deteriorating spore-forming wastewater : A critical review. Journal of Water Process bacteria from milk. Semina:Ciencias Agrarias, 37(5), 3069– Engineering, 41(March), 102041. https://doi.org/10.1016/j. 3078. https://doi.org/10.5433/1679-0359.2016v37n5p3069. jwpe.2021.102041. Song, H.-K., Won Cho, K., & Lee, K.-H. (1998). Adsorption Ezeuko, A. S., Ojemaye, M. O., Okoh, O. O., & Okoh, A. I. of carbon dioxide on the chemically modified silica (2021b). Technological advancement for eliminating adsorbents. Journal of Non-Crystalline Solids, 242(2), antibiotic resistance genes from wastewater: A review of 69–80. https://doi.org/https://doi.org/10.1016/S0022- their mechanisms and progress. Journal of Environmental 3093(98)00793-5. Chemical Engineering (Vol. 9, Issue 5). https://doi. Titilawo, Y., Obi, L., & Okoh, A. (2015). Occurrence of virulence org/10.1016/j.jece.2021.106183. gene signatures associated with diarrhoeagenic and non- Ezeuko, A. S., Ojemaye, M. O., Okoh, O. O., & Okoh, A. I. diarrhoeagenic pathovars of Escherichia coli isolates (2022). OpenNano The effectiveness of silver nanoparticles from some selected rivers in South-Western Nigeria. BMC as a clean-up material for water polluted with bacteria Microbiology, 15(1), 1–14. https://doi.org/10.1186/s12866- DNA conveying antibiotics resistance genes : Effect of 015-0540-3. different molar concentrations and competing ions. Wang, Y., Zhou, Y., Zhang, T., He, M., & Bu, X. (2014). Two- OpenNano, 7(July), 100060. https://doi.org/10.1016/j. dimensional ultrathin nanosheets of Ni-In-layered double onano.2022.100060. hydroxides prepared in water enhance DNA adsorption Humphries, R., Bobenchik, A. M., Hindler, J. A., & Schuetz, performance. RSC Advances, 4(57), 29968–29974. https:// A. N. (2021). Overview of Changes to the Clinical and doi.org/10.1039/c3ra47728b. Laboratory Standards Institute Performance Standards Zhang, X.-X., Zhang, T., & Fang, H. H. P. (2009). Antibiotic for Antimicrobial Susceptibility Testing, M100, 31st Edition. resistance genes in the water environment. Applied Journal of Clinical Microbiology, 59(12), e0021321. https:// Microbiology and Biotechnology, 82(3), 397–414. https://doi. doi.org/10.1128/JCM.00213-21. org/10.1007/s00253-008-1829-z. Research Report 2021/2022 | 24

NATURAL AND AGRICULTURAL SCIENCES Making choices for the future: UFH research informs thinking about the feasibility of rooftop solar systems Oyeniyi A. Alimi, Edson L. Meyer, Olufemi I. Olayiwola, Ochuko K. Overen summer mean temperature would of five hailstorms has occurred in the result in a 40% increase in the the Raymond Mhlaba Municipality (RMM) severity of hailstorms, which occur and at least two have caused major when a thunderstoom updraught lifts damage to infrastructure. water droplets above the freezing A hailstorm that occurred on level in the atmosphere. In South September 30, 2022 was categorised Africa, the mean annual temperature as H3 on the Tornado and Storm has increased at least 1.5 times the Research Organisation (TORRO) scale observed global average increase of as it caused considerable damage 0.65°C during the last 50 years as a to exposed infrastructure including result of global warming. All this gives rooftop solar PV modules. The TORRO rise to questions about the feasibility scale ranges from H0 to H10, where of solar-powered PV systems if the H0 corresponds to ‘no damage’ and likelihood of costly damage increases. H10 corresponds to ‘catastrophic Dr Oyeni A. Alimi The Misgund area in the Langkloof damage’. Valley as well as the southern slopes Concerns about the adverse effect of oncern for the environment of the Winterberg Mountains in the extreme weather events on solar PV along with rising costs and Eastern Cape (north of Somerset East systems led the UFH research team Cloadshedding has resulted in to north of Fort Beaufort) are popular to investigate their impact on the an increased number of people and hailstorm ‘hotspots’ in South Africa. In feasibility of the systems themselves businesses turning to solar power for the last four months, a record number their energy needs. While there are many benefits to having photovoltaic (PV) panels installed on rooftops, systems can be damaged by extreme weather events such as hailstorms. An experimental analysis conducted by a University of Fort Hare research team consisting of Dr Oyeniy Alimi, Professor Edson Meyer, doctoral candidate Olufemi I. Olayiwola and Professor Ochuko Overen showed Figure 1. Occurrence, severity and cumulative duration of hailstorms in that every 1°C increase in the Raymond Mhlaba municipality Dec. 2021 – Sept. 2022 25 | University of Fort Hare

NATURAL AND AGRICULTURAL SCIENCES result of savings is referred to as the ‘payback time’. The cost of replacing PV modules significantly damaged by these hailstorms has been calculated as R 53,500. All this means that consideration needs to be given to whether or not solar PV systems will be sustainable or financially viable if adverse weather events increase as a result of climate change. Given annual solar radiation levels, Alice has the potential for significant solar PV power generation, with the result that a strong argument can be made for a campus that is completely solar powered on the basis of cost savings. However, climate change may mean that this argument has to be revisited as an increase in severe weather events results in damage that reduces generation Figure 2. Images from the hailstorm event in Alice on September 30, 2022: power. This then leaves arguments (a) dimension of some hailstones, (b) damaged property and (c) impact of about the value of solar PV systems hailstones on solar PV modules in contributing to sustainability. Regardless of the focus of future in a study that involved monitoring One of the reasons for installing solar discussions, the University will be able the systems installed at SolarWatt PV systems is to save on energy costs, to count on its own researchers at the Park on the Alice Campus. with consumers often calculating Fort Hare Institute of Technology and the time it will take for savings in the associated departments to provide Monitoring of the 6 year old cost of buying electricity to cover the sound research-based advice, as the polycrystalline modules installed on cost of installation. The period taken study reported above shows. the rooftops at SolarWatt Park after to cover the cost of the system as a the first hailstorm in December 2021 revealed a drop in obtainable power output of about 13%. After the second severe storm on September 30, 2022, the output further dipped by another 17% for a moderately damaged module and 62% for a module with major cracks (Figure 2). The system at SolarWatt Park was initially designed to generate a minimum of 7.875 kWh per annum. However, in its current state, it can only generate about 2.520 kWh per annum since more than half of the Figure 3. Electrical characterisation of the solar PV modules before and modules have been badly damaged. after the hailstorm Research Report 2021/2022 | 26

Health Sciences 27 | University of Fort Hare

Research Report 2021/2022 | 28

HEALTH SCIENCES Identifying misconceptions about tuberculosis: A step forward in developing effective awareness campaigns Peggy Onyango, Professor Daniel Ter Goon and Ntombana Rala outh Africa carries a particularly Findings from the study indicate the threat of stigma associated with high burden of cases of widespread misconceptions about HIV also adds to a failure to seek a S tuberculosis (TB) with 3% of all causes of the disease. For example, diagnosis and get treatment. cases reported worldwide occurring 76.5% of respondents expressed Treatment for TB can be lengthy and here. Of even more concern is the the belief that TB was caused by cold requires repeated visits to health fact that the country also has a high air, 85.9% claimed that it was due facilities for testing and check-ups. number of cases of drug-resistant TB. to a dusty environment and 84.7% The majority of respondents (87.2%) Reasons cited for the high prevalence indicated smoking as a cause with were aware that treatment took six of the disease often include poverty many (60.6%) claiming that people months or longer, with 70.6% noting and poor, overcrowded housing who smoke and drink are responsible that they thought follow-up sputum for its spread. Nonetheless, the conditions. However, lack of tests were an important part of knowledge about the disease itself in largest proportion of participants in treatment. However, more than half a country where levels of education the study (88.4%) did identify correctly said they thought treatment for TB are generally low is undoubtedly also the presence of TB bacteria in the air was unpleasant and interfered with a factor. as a cause. work or marriage, with the majority The need to be more conscious of Importantly, participants in the study indicating stigmatisation as the main the way TB is understood and how shared misconceptions about the reason for avoiding follow up visits at understandings relate to behaviour relationship of TB to HIV, with 77.4% clinics. Given these results, it is not led to a study conducted by Nurse claiming that TB could develop difficult to see why many patients fail Peggy Onyango, Professor Daniel into HIV and that HIV infects those to follow up on their treatment. Ter Goon and Nurse Ntombana Rala. suffering from TB. According to the Although 53.5% of those who The research project focused on 327 researchers, these misconceptions completed the questionnaire did patients suffering from TB attending could be related to the fact that South not associate TB with poverty, the three community health centres Africa has a high incidence of HIV multivariate logistic regression in the Nelson Mandela Bay Health and TB is a major cause of death for analysis conducted by the researchers District. The three researchers used a those infected with both TB and HIV. showed that place of residence was a close-ended questionnaire to collect The belief that TB develops into HIV factor that was statistically significant, information for the study and used was also identified as an explanation with residence in formal housing descriptive and multivariate logistic for some patients choosing to hide emerging as a predictor of correct regression analyses to work with data. symptoms, resulting in a delay in knowledge. getting medical advice. In addition, 29 | University of Fort Hare

HEALTH SCIENCES A lack of knowledge about TB along with people’s attitudes towards the disease and delays in seeking health advice are all factors linked to mortality from the disease. Because of this the three researchers identify the need Reference: to scale up TB programmes and to Onyango, P.A., Goon, D.T, & Rala, N. M. D. (2020). focus on stigma-related perceptions Knowledge, attitudes and health-seeking behaviour and attitudes. This important study among patients with tuberculosis: a cross-sectional thus contributes to ways South Africa study. The Open Public Health Journal, 13(1). could begin to lessen the burden of TB on its population by developing research-based campaigns that ensure misconceptions about the disease are challenged and people are provided with the information that will encourage healthy behaviour. Research Report 2021/2022 | 30

HEALTH SCIENCES The link between crime and mental health in South Africa Ruth Eister, Dr JD Wagner, Jenny Muller and Shirley Jaftha rime is a concern to all South of 2022 saw a 70.5% increase in were perpetrated mostly by someone Africans regardless of where the murder of women and a 37.2% known to the victim. Cthey live or who they are. In increase in the murder of children. Crime can change the lives of its South Africa, a 9.3% increase in crime Rape has also increased dramatically victims by affecting their mental was reported in the first quarter with almost 11,000 cases reported health negatively, as members of of 2022 with about 6,083 murders to police. The South African Police the Psychiatric Nursing Team in the occurring in this period. Those most report that a ‘staggering’ 4,653 rapes Department of Health Sciences, Ruth affected by crime are the vulnerable took place at the home of the rape Eister, Dr JD Wagner, Jenny Muller and members of society. The first quarter victim or the home of the rapist and Shirley Jaftha, can attest. Members 31 | University of Fort Hare

HEALTH SCIENCES Jennifer Muller Dr J.D. Wagner of the Team draw on a deep pool bodily harm, 3,695 were reported people with psychosocial problems of expertise on the relationship as related to substance abuse. For and intellectual disabilities. SAFMH between crime and mental health members of the Psychiatric Nursing also advocates against unnecessary and are particularly alert to the fact Team, these facts and figures stress institutionalization and promotes that crime is worsened by substance the need to address alcohol and community psychiatric care. The abuse and that both substance substance abuse if crime is to be SADAG advocates for the promotion abuse and crime affect mental reduced of mental health. It runs a toll-free health. South Africa is home to about service for various mental health According to members of the team, 58,78 million people with those problems for all affected, assists the COVID-19 pandemic highlighted aged between 10 and 34 making callers in resolving their mental the relationship between substance up about a third of this number. health issues, provides free online abuse and crime in South Africa. Half of all mental health disorders training to people who initiate a According to the Governance, Public begin by the age of 14. However, the support group in their communities, Safety, and Justice Survey 2020/21 majority of instances go unnoticed and gives ongoing assistance to such released by Statistics South Africa, and untreated with anxiety, post- groups. SADAG is currently linked to crime levels dropped during the traumatic stress disorder and 160 support groups. They also assist period 2020/2021 when strict depression noted as conditions with callers with substance abuse, suicide COVID-19 pandemic restrictions the highest occurrence rates. risk, work stress related issues and and a ban on the sale of alcohol so on. were in place. This shows that when However, as the Psychiatric Nursing Although national organisations do alcohol use is reduced, instances Team are eager to note, those exist, the University of Fort Hare is of crime and violence also fall in suffering from mental ill health do extremely fortunate to have a pool number. Liquor outlets are the third not need to suffer alone. Help is of researchers whose expertise in most likely place to be murdered in available from the South African Psychiatric Nursing Science makes South Africa. Of the 9,556 rape cases Federation for Mental Health them an invaluable resource to all reported in the first quarter of 2022, (SAFMH) and the South African members of the university and the liquor and drugs were reported Depression and Anxiety Group communities it serves with regard to as involved in 1,383. Amongst the (SADAG). The SAFMH, a national NGO the relationship between crime and 72,762 cases of assault and grievous and an association of mental health mental health. practitioners, promotes the rights of Research Report 2021/2022 | 32

HEALTH SCIENCES Making a difference in the health of local communities: The work of the HIV/ AIDS Research Group Helen Bunt IV and AIDS have been with us poorest provinces in the country calls for a long time and the idea for work that acknowledges the social Hthat they present a serious and economic conditions in which threat to health may have lessened local communities live. The UFH HIV/ particularly given the prominence AIDS Research Group is committed given to Covid-19 over the past to producing knowledge that few years. Against this background, addresses local challenges through information presented at the recent engagement in research networks, th sharing information and fostering 24 International AIDS Conference in Montreal, Canada (29 July – 2 August, collaboration with others. The newly 2022) makes frightening reading. formed Research group is made up Decreased funding and worsening of a number of representatives from economic conditions have resulted the Department of Health, various in less HIV testing, fewer care and non-governmental organisations (NGO) and staff members who are prevention programmes, more instances of stocks of medication and all involved in some area of HIV other supplies running low or running / AIDS research. The research of out and more failures in following up members of the group located at on cases identified. As a result, more UFH focuses on viral load monitoring patients are now presenting with AIDS by professional nurses as well as and very low counts of the cells that the dynamics involved in disclosure Helen Bunt can move through the body finding of HIV status among adolescents. and destroying bacteria and viruses. The team is also investigating the This then allows for opportunistic experiences of COVID-19 pandemic diseases, such as tuberculosis and on the elderly living with HIV as well as cryptococcal meningitis, both leading the development of a care app for HIV causes of death, to take hold. positive pregnant women. Health care challenges are always The Research Group in the process of more complex in poor, rural areas forming a collaboration with Dr Elona and this makes the work of the HIV/ Tosca of the University of Cape Town. AIDS Research Group in the Faculty Dr Tosca has conducted extensive of Health Sciences at the University research on the devastating effects of Fort Hare all the more critical. The of violence on mental health and on location of the University in one of the adherence to treatment protocols 33 | University of Fort Hare

HEALTH SCIENCES in collaboration with the Accelerate conducting a handheld test while in deeply. Yet again, the work of the Hub, a group committed to working the home itself. If the test is positive, UFH Research Group demonstrates with adolescents in resource poor the entire household is asked to go to sensitivity to local contexts. contexts in Africa. the clinic as a group. Members of the Research Group Another partnership enjoyed by The need to make the best of limited also partner with another NGO, the Research Group involves the health services in rural areas also led BeyondZero, focused on investigating Desmond Tutu Research Foundation’s to the development of a screening best practices in HIV prevention (DTRF) Dr Andrew Marino. Dr Marino’s tool which reduces demands on programmes. Professor Mzi Nduna focus is on screening for sexually the time of professional nurses in of the Department of Public Health transmitted infections (STIs), pre- primary health clinics. Statistics show has extensive experience of working exposure prophylaxis (PrEP) and that almost half of health care users in the field of sexual minorities and anti-retroviral therapy (ART). The in the Eastern Cape have mental adolescent sexual health and brings prevalence of tuberculosis (TB) among health needs even though they go to this in-depth expertise to studies men in the Amathole District is almost clinics complaining about symptoms conducted by the Group. double that which is internationally associated with another condition The commitment of researchers at accepted as a crisis level. Further such as high blood pressure. Mental the University of Fort Hare to making research undertaken by Dr Marino health issues including underlying a difference in the lives of South and the DTRF shows a relationship stress, anxiety or depression can then Africans, particularly those living in between mental health (especially go undetected and untreated. The the Eastern Cape, is evident in many depression) and TB rates and has innovation involves the introduction of the accounts of studies in this also resulted in a testing innovation of a short screening tool to check for research report. The work of the HIV/ particularly suitable for households mental health issues. If a potential AIDS Research Group undoubtedly in poor rural areas. The innovation problem is then identified, nurses can provides a shining example of this involves pooling the sputum of use a more rigorous tool involving and needs to be applauded loudly. all members of a household and thirty questions to probe more Research Report 2021/2022 | 34

HEALTH SCIENCES Learning from African Traditional Medicine: Fort Hare researcher leads the way of a research programme that will provide the acknowledgment denied to the indigenous knowledge used by healers for centuries. Medicinal plants have long been used in the development of drug therapies, and recent research in this area has focused on new treatment and management of diseases such as malaria, cancer and diabetes. African traditional medicine draws on medicinal plants, and healers have a wealth of knowledge and understanding about their use. The purpose of the ATM Research Unit is to promote IKS by contributing to the body of knowledge concerning the safety and efficacy of African traditional medicine. The focus of the Unit will be to draw on indigenous knowledge systems in the treatment of the top five diseases encountered in the Eastern Cape. Importantly, Dr Bongani Alphouse Nkala researchers will seek to go beyond simply treating indigenous knowers as knowledge holders to be used r Bongani Alphouse Nkala of the as sources of information. The aim Integrative Medical Research is to involve them in the studies DUnit (IMRU) in the Faculty of themselves, a goal which gives Health Sciences is passionate about meaning to claims that indigenous indigenous knowledge systems and knowledge should be valued and their role in treating disease. One brought into the university. Another of Dr Nkala’s many successes has aim is to ensure that indigenous involved the establishment of an knowers are able to benefit from any African Traditional Medicine (ATM) financial gains that result from the Research Unit within the IMRU, application of their knowledge. accompanied by the development 35 | University of Fort Hare

HEALTH SCIENCES Also important is the fact that the on traditional medicine common The next stage of the project will research programme designed by to a locality in order to compile a involve the discovery and repurposing Dr Nkala will involve Master’s and database. It will also involve collecting, of the traditional medicines identified, doctoral students from a range of classifying and allocating specimen through documenting, characterising disciplines, including Biochemistry, numbers to samples of leaves, bark and determining their efficacy. Finally, and herbs which will be stored in the new or useful established drugs Biotechnology, Environmental Studies, Clinical Medicine and University’s herbarium. identified in previous studies can be Pharmacology. Students will produce Studies will then move on to drawn upon for commercial use. studies that will contribute to The exciting and innovative developing the knowledge necessary determining and characterising to fulfil the goals of the ATM Unit. the efficacy of traditional medicine programme set out by Dr Nkala aims by drawing on modern techniques to attract local and international The first step in the research including antibiotic testing and clinical collaborators who want to contribute programme will involve documenting testing. This stage of the research to the quality of life of those living existing knowledge by gathering will involve Master’s and doctoral in the Eastern Cape and beyond, anecdotal evidence and using this students working in Biochemistry, once again showing the ability and to construct systematic bodies Biotechnology and Environmental commitment of UFH researchers to of knowledge. In this phase of Science. work at a global level with the local the research, studies will focus firmly in focus. Research Report 2021/2022 | 36

HEALTH SCIENCES Keeping active: promoting the benefits of physical activity and exercise for pregnant women Dr Uchenna Okafor and Professor Daniel Ter Goon of the published work being reviewed. provision of conflicting information, shared awareness of the relationship between physical Using different databases, Dr Okafor along with tiredness, discomfort, lack of A activity and exercise and health and Professor Goon retrieved original time, low energy, a lack of opportunity to exercise and safety concerns for brought together doctoral candidate peer-reviewed research articles Dr Uchenna Okafor of the Department reporting on the prenatal physical both the mother and the baby, all of Nursing Science and supervisor activity and exercise practices of functioned to limit their participation in physical exercise and activity. Professor Daniel Ter Goon of the healthcare providers published Department of Public Health at the between 2010 and 2020. The original As a result of this part of their project, University of Fort Hare for a study search identified 82 articles of which Dr Okafor and Professor Goon were focused on the development of 13 were eventually judged to meet the able to identify the need for an an intervention that would benefit criteria for inclusion in the study. approach to providing information pregnant women and their babies. The The review of published work showed about the benefits of physical activity study not only resulted in the award that, although healthcare providers and exercise involving multidisciplinary of a doctoral degree but also the accepted responsibility for counselling health teams drawing on both printed publication of four journal articles. pregnant women about physical materials and social media. The next Over the years, a wealth of evidence activity and exercise, advice was step was for the two researchers to has been produced showing that offered infrequently, with insufficient study some of the healthcare providers physical activity and exercise during time, a lack of knowledge and skills, themselves by engaging in a series of pregnancy are highly beneficial. The inadequate or insufficient training, and interviews with 15 midwives working need for prenatal healthcare providers a lack of resources being most often at health care facilities in the Eastern to create awareness and encourage cited as reasons for this. As a result of Cape. pregnant women to engage in physical this review, Dr Okafor and Professor The findings of this stage in the project activity is therefore very important. The Goon came to conclude that prenatal showed that midwives rarely provided project conducted by Dr Okafor and exercise and activity was a neglected advice on physical activity and exercise Professor Goon began with a scoping component in efforts to improve the to women attending antenatal clinics. review of published work in order to health of pregnant women. When information on physical activity achieve two goals. The first goal was The next step in the project involved a and exercise was provided, it was to assess the knowledge, attitudes study involving more than a thousand often inadequate as midwives had and practices of prenatal healthcare pregnant women receiving antenatal received no training on the benefits of providers in offering advice about care in selected health facilities in physical activity during pregnancy. The prenatal physical activity and exercise. Buffalo City Municipality. The aim of shortage of midwives only exacerbated The second was to identify barriers to this part of the project was to identify the situation with participants in the the provision of this advice. the barriers to women engaging in study noting that they worked to busy In order to conduct the review, the physical activity and exercise. Dr schedules and carried many official researchers drew on the Preferred Okafor and Professor Goon drew on responsibilities. In spite of this, the Reporting Items for Systematic a mixed methods approach, which midwives did recognise the importance Reviews and Meta-analyses (PRISMA), showed that the women in the study of physical activity in improving the a 27-item checklist covering all aspects claimed that a lack of advice or the health of the mothers attending the 37 | University of Fort Hare

HEALTH SCIENCES Economic Growth, Socio-Cultural, Pregnancy can be a trying time for Technological Environmental (PESTLE) many mothers-to-be regardless of framework, and the Build, Overcome, whether they are pregnant for the Explore and Minimise (BOEM) first time or have already given birth framework. These frameworks were to other children. Although all women first used in discussions with academic want to maintain their health and and professionals with a background eventually give birth to healthy babies, and interest in maternal health. Dr in busy lives with multiple demands it Okafor and Professor Goon then can be only too easy to overlook the proceeded to use the frameworks as need for conscious attention to be a basis for research with stakeholders paid to keeping active and exercising. that included antenatal health clinic There is no doubt, however, that the managers, antenatal midwives, and project undertaken by Dr Okafor and pregnant women themselves. Professor Goon will go a long way in As a result of this study, the two promoting the benefits of physical researchers were able to identify a activity and exercise amongst pregnant clinics and expressed a willingness women thanks to the evidence-based to engage in education and training number of strategies that could be approach of their research. programmes that would allow them to used to develop an overall intervention counsel pregnant women. Importantly, promoting the benefits of physical References: the midwives recommended the use of activity and exercise for pregnant Okafor UB, Goon DT. Physical an app, called ‘Mom-Connect’, designed women. Strategies included the: activity advice and counselling by the National Department of Health • Use of apps such as Mom-Connect to by healthcare providers: A in order to provide information about provide information on the benefits scoping review. Healthcare, 2021, maternal and child health. Currently of physical activity and exercise to 9:609. https://doi.org/10.3390/ the Mom-Connect app does not carry pregnant women; healthcare9050609 any content related to physical activity and exercise. • Establishment of partnerships with Okafor UB, Goon DT. Uncovering the various cell phone and network barriers to prenatal physical activity Engagement with the midwives as companies operating in South Africa and exercise among South African research participants allowed Dr Okafor to assist in sharing information on pregnant women: A cross-sectional, and Professor Goon to identify the the benefits of physical activity and mixed-methods analysis. Frontiers need for research to develop content exercise; in Public Health, 2022. on physical activity and exercise for the app. They were also able to note • Integration of prenatal physical Okafor UB, Goon DT. Providing the need for healthcare providers to activity and exercise training into physical activity advice during prioritise advice on physical exercise medical and health curricula to pregnancy: A qualitative study of and activity in antenatal sessions and equip healthcare providers with the nurses’ perspectives. Nigeria Journal for more information in the form of knowledge and skills necessary to of Clinical Practice, 2021, 24:718-28. pamphlets, posters and DVDs to be prescribe prenatal physical activity DOI:10.4103/njcp.njcp_486_20. developed. and provide counselling on it; Okafor UB, Goon DT. Development Dr Okafor and Professor Goon then • Development of campaigns to and validation of prenatal physical moved on to developing a strategy to address the lack of awareness, activity intervention strategy for misrepresentations, and other promote physical activity and exercise women in Buffalo City Municipality, amongst pregnant women. In order concerns about the safety and South Africa. Healthcare, 2021, to do this, the two researchers drew benefits of prenatal physical activity; 9(11):1445. https://doi.org/10.3390/ on three frameworks: the Strength, • Incorporation of antenatal physical healthcare9111445. Weakness, Opportunity and Threat activity and exercise classes into (SWOT) framework, the Political, routine antenatal clinics. Research Report 2021/2022 | 38

HEALTH SCIENCES Promoting exercise and healthy eating amongst farmers Professor Leon van Niekerk and Professor Daniel Ter Goon he Covid-19 pandemic affected all sectors of society in all countries across the world. As the virus T spread, concerns were raised in the international media about its impact on food security because of disruptions to global supply chains and work in food processing plants. In spite of this concern for food production and distribution at a global level, little attention was paid to the effects of the virus and attempts to control it on the very farming communities that produce the food we eat, especially in developing countries such as South Africa. However, the need to understand the consequences of the pandemic for the physical and mental health of farmers and farm workers did not escape the attention of two eminent University of Fort Hare researchers, Professor Leon van Niekerk of the Department of Human Movement Science and Professor Daniel Ter Goon of the Department of Public Health. Specialist in sport psychology Professor Professor Leon van Niekerk Leon van Niekerk has a long history of research into the impact of physical inactivity on mental health. This interest in the effects of activity is shared by Professor Daniel Ter Goon who, amongst other things, has researched and published on the epidemiology of activity and the relationship between levels of physical activity and chronic disease for many years. Both researchers quickly identified the need to know more about 39 | University of Fort Hare

HEALTH SCIENCES the effects of the pandemic on the to moderate levels of psychological was that physical activity and exercise farmers and farm workers engaged distress. Although most of the benefited the farmers at a time when in producing the food that would farmers (69% of those sampled) they were experiencing enormous feed into supply chains and would be reported engaging in enough physical stress. As a result, Professors van processed for consumption. activity and exercise, only 22.2% Niekerk and Goon recommend the This then resulted in the design achieved the 150 to 300 minutes of promotion of exercise for farming of a study which used a survey moderate aerobic activity or exercise communities. administered to 212 commercial, per week recommended by the World Apart from its contribution to small-scale and emerging farmers Health Organisation (WHO). All the scientific knowledge, this study with an average age of 37.5 years farmers who reported in engaging in demonstrates a commitment to engaged in livestock, poultry, enough physical activity or exercise research with the potential to impact vegetable and crop production. The noted that this benefited their mental on local communities. It also provides survey showed that, although only health. However, those who reported lessons for anyone reading this about 20% of those who participated only engaging in ‘enough’ physical article. The pandemic led to increased contracted the virus (and an even activity or exercise found that this stress levels for everyone, regardless smaller proportion were ill enough to did not contribute to physical health of their occupation. How many of us require hospitalisation), the impact of benefits. used physical exercise and activity activity and exercise on their mental The two researchers also found to reduce stress and improve our well-being was very important. that 36.5% of the farmers in their physical health even within the The pandemic affected food study were overweight and 30.7% constraints of lockdown? Thanks are production and trading and, as a were obese. Although they identify due to Professors van Niekerk and result, income dropped, leading to the potential impact of diet in their Goon for providing us all with food one in three of the farmers who took paper reporting on the study, the for thought about what we can do to part in the survey reporting that they, study itself did not assess this improve and maintain our health in and their workers, experienced mild specifically. However, what was clear the future. Research Report 2021/2022 | 40

41 | University of Fort Hare

Management and Commerce Research Report 2021/2022 | 42

MANAGEMENT AND COMMERCE Using technology in teaching and learning: Important insights from Fort Hare study Wendy Terblanche, Lubbe, I., Papageorgiou, E. & van der Merwe, N pronouncements sit in well-resourced The study drew on the Unified Theory countries and know very little about of Acceptance and Use of Technology the challenges experienced by (UTAUT2) developed by Viswanath students and academic teachers in Venkatesh and colleagues at Virginia less developed parts of the world. Tech in the United States. UTAUT2 The second problem is that we have holds that the adoption of technology very little ‘hard’, rigorously reviewed is affected by users’ expectations academic research to back up the about the way it will work for them, by claims. the effort they will have to put in, by These observations about the status social and cultural factors influencing of claims make a paper published by users themselves and, also, by the a team of researchers led by Wendy extent to which the conditions in Terblanche of the Nkuhlu Department which the technology is introduced of Accounting at the University of Fort facilitate its use. Hare (UFH) investigating the adoption The aim of the study was to identify the of technology by students at four determinants of students’ acceptance South African universities, all the more of e-learning applications and, also, important. Other members of the how these determinants could be team were Ilse Lubbe of the College moderated in some way. An original Wendy Terblanche of Accounting at the University of UTAUT2 questionnaire had to be Cape Town, Elmarie Papageorgiou adapted for the South African context laims that higher education will of the School of Accountancy at in order to conduct the research, and never be the same following the University of the Witwatersrand Structural Equation Modelling (SEM) Cthe shift to online learning and Nico van der Merwe of the was used to analyse the results. The during the pandemic abound in the School of Accounting Sciences at the study confirmed the UTAUT2 model press as well as in the academic North-West University. The multi- in a cross-institutional setting using literature on teaching and learning. institutional nature of the team and a larger sample size than had been For many, the shift to online learning the fact that the study was conducted drawn upon in previous studies. This means that residential universities will at four South African universities in itself constituted an important be challenged in the future as more during the Covid-19 lockdown contribution to knowledge. and more students come to prefer period means that the sample of More importantly for teaching and e-learning. However, we should not 1864 students who participated in learning, the study showed that, for accept these claims unquestioningly the study not only drew on various blended or online learning models for at least two reasons. The first is demographic variables but also on to succeed in contexts such as those that many of those making these experiences of individuals studying at studied, students need to be exposed different institutions. 43 | University of Fort Hare

MANAGEMENT AND COMMERCE to technology on an ongoing basis. It to questions about the price value when it allows for their engagement would seem that the more familiar of e-learning applications. What the with academic teachers and other students are with using technology, research shows, therefore, is that if students and is ‘safe’ as it does so. the more willing they are to use it. universities want to continue to use Given the potential of social media Also of interest to academic teachers technology in teaching and learning, to impact on psychological well- was that analysis of results showed they will need to provide support for being, this insight into the need to that 34% of students responded the acquisition of devices and use of make e-learning environments ‘safe’ negatively to the idea that using data and not see this as something and unstressful is really important. technology would result in higher that only happened in the emergency Also important was the finding that marks. conditions of the pandemic. a digital gap between males and Generally, students agreed with Given the enormous concern about females could not be identified. statements in the questionnaire the environments in which students This important study by Wendy about the value of resources and learn, the finding that questions Terblanche and her colleagues has having the knowledge and assistance about the impact of social context on important implications going forward available to use it. During the students’ learning generally received for a range of people including pandemic, all the universities involved a positive response is very important. higher education policy-makers in the study had made laptops and Only one third of respondents and leaders as well as university data available to students and also indicated that social factors impacted teachers themselves. The publication sought to accommodate those negatively on using technology for of results in a leading South African whose home environments made learning. journal contributes to what is still a studying difficult. This could explain relatively small volume of rigorously Interestingly, students provided the relatively low number of students neutral to slightly negative responses produced knowledge on the move reporting that conditions during the about the fun and enjoyment to to using e-learning technologies and pandemic were not conducive to their be gained from using e-learning highlights the role of UFH in producing learning. The fact that students in knowledge on teaching and learning applications. Students reported need received laptops and data could experiencing e-learning as fun with the potential to contribute to also explain the positive response global understandings. Reference: Terblanche, W., Lubbe, I., Papageorgiou, E. & van der Merwe, N. 2022. Acceptance of e-learning applications by accounting students in an online learning environment at residential universities. South African Journal of Accounting Research. https://0- doi.org.wam.seals. ac.za/10.1080/ 10291954.2022.2101328 Research Report 2021/2022 | 44

MANAGEMENT AND COMMERCE Forging partnerships for excellence - The role of the African University Professor Willie Chinyamurindi for the role of universities on the continent in the pursuit of economic and political liberation. Key to his argument is the need for Africa- Africa partnerships. According to Professor Chinyamurindi, during the Covid-19 pandemic, technology allowed collaborations to emerge and thrive when travel and in- person meetings were impossible. Post pandemic, the uncertainties that have emerged across the world mean that it is important that these technology-driven collaborations continue. In Professor Chinamurindi’s opinion, The newly formed Human Capital Management research in Africa the situation remains interest group at Mulungushi University in Zambia ominous and attention to three foci is n important influence on understanding of the way indigenous needed to allow the continent to fulfil the thinking of Professor knowledge systems had been set its potential. Firstly, universities need AWillie Chinyamurindi of aside in order to privilege Western to contribute to the development the Department of Business ‘science’, a point taken up by those of a skilled workforce of a world- Management is the late Ali Mazrui, the arguing for the decolonization of the class standard. The training of this Kenyan born thinker who advocated universities in South Africa today. workforce has to be focused on for a transformed role for African Also central to his arguments was the ability to solve local challenges. universities in the liberation of the the role African universities needed This is especially important in the African. Mazrui was an ardent critic to play in changing the material context of the Fourth Industrial of Western economic systems and conditions of African people. For Revolution. The development of saw African universities as serving Mazrui, the universities are part of a skilled workforce will need to be these systems and their offshoots. the economic and political liberation accompanied by talent management In an age where globalization has of the continent itself. programmes. Remuneration will also seen universities across the world need attention if the so called ‘brain moving towards one vision of what Professor Chinyamurindi, well known drain’ involving the loss of African they could and should be, Mazrui because of his travels throughout intellectual capacity to Western was at the forefront of some of the Africa funded by the National economies is to be halted. critiques of higher education that are Institute for the Humanities and A second priority for Professor only emerging elsewhere now. Social Sciences’ (NIHSS) African Chinamurindi is investment in Pathways Programme, has taken up technologies and universities. The Key to Mazrui’s thinking was an Mazrui’s ideas in work making a case 45 | University of Fort Hare

MANAGEMENT AND COMMERCE development of new technologies, Deloitte in 2021. However, the Chinyamurindi’s own efforts to forge and not simply the adoption of focus needs to be on investment Africa-Africa partnerships have those that exist already, is key to the in infrastructure that encourages included participation in the Human future of the continent. Affordable connectivity, especially between Capital Management Research high speed internet connectivity is African universities. Interest group at Mulungushi a basic if development needs are The critical role of partnerships in University in Zambia and in a writing to be addressed. Also important is achieving these three steps is critical. retreat at the University of Lusaka. the need for technology in sectors Collaboration on the continent Universities targeted in the UFH where people trade informally. maximises economies of scale, strategy include Makerere University The role of the African university fosters synergies and is beneficial to Business School in Uganda, the in developing technology, and not all involved. Investment which allows University of Gondar in Ethiopia, the simply adopting it, and promoting the universities to collaborate on a University of Kigali in Rwanda and the innovations in its use is key to this continental scale will not only benefit University of Lusaka and Mulungushi process. As many African countries the institutions themselves but also University in Zambia. have young populations, investment the communities in which they are Africa-Africa research partnerships in this demographic and the ability located. attest to the need for those on of young people to engage with the continent to work together technology is essential especially as The University of Fort Hare is espoused by intellectuals and social many see universities as a means of prioritizing Africa-Africa partnerships. activists such as Mazrui. In spite of attaining the skills necessary to gain At the core of these partnerships obstinate challenges, Africans can the workforce. is collaboration in research, joint rescript their identity by answering A third task involves addressing teaching, the development of new the clarion call outlined by Professor challenges related to infrastructure, curricula, the development and Chinyamurindi and, in doing so, they identified as an obstacle to economic delivery of short courses, and the can hasten their steps towards the growth in a report published by training of undergraduate and liberation of the continent. postgraduate students. Professor Delegates attending South Africa – Zambia Writing Workshop at the University of Lusaka Research Report 2021/2022 | 46

MANAGEMENT AND COMMERCE Improving service delivery through e-government Dr Ayanda Madyibi and Professor Roxanne Piderit ervice delivery’ is a term on the country means that many lack the lips of many South Africans as knowledge and skills to do so. they try to access provision S from the government and rarely Thusong Service Centres were a day goes by when news reports set up in an attempt to bring do not show protests objecting information and services closer to to failures in this area. However, the people. However, a 2018 review a doctoral study conducted Dr conducted by the Department of Ayanda Madyibi, Information and Public Service and Administration Digital Technology Specialist at (DPSA) showed that the Centres the Eastern Cape Socio-Economic were not functioning as well as Consultative Council (ECSECC) and intended for a number of reasons a member of the Advisory Board including the state of their physical of the Department of Information infrastructure and the model of Systems, supervised by Professor funding used to support them. Roxanne Piderit of the Department An earlier study had identified of Information Systems has gone perceptions that Thusong Service some way in addressing problems Centres suffered from poor service in the way the government goes delivery, were not user friendly and Professor Roxanne Piderit about providing public services via also noted the limited use of the ICT what is known as ‘E-government’. related services they offered. E-government is a way of interacting The study conducted by Dr Madyibi with citizens using Information and Professor Piderit aimed to and Communication Technologies address the lack of research on (ICTs). Government departments e-Government in less developed have websites but not all are as well countries and, more practically, to developed as they could be in the develop a framework to enhance its sense of allowing citizens to access implementation in Thusong Service the services they need online. Centres. The research project Although E-government has been began with a review of the literature studied in developed countries, in order to construct a conceptual much less is known about its framework that was then applied to adoption and use less developed the Thusong Service Centres in the nations where the situation is very Eastern Cape as a case study so as different. Many South Africans do to confirm and refine it. not have access to the devices or Confirming and refining the data that will allow them to access framework then involved services provided electronically. collecting empirical data from In addition, the history of our twenty-two organisational and 47 | University of Fort Hare

MANAGEMENT AND COMMERCE five user perspectives including i) the two main factors influencing the Thanks to the collaboration of doctoral the State Information Technology technological context. candidate and supervisor, we are a Agency (SITA) as an agency of As a result of this analysis, Dr Madyibi, step closer to a future where citizens government responsible for ICT in under Professor Piderit’s guidance, can access government services in South Africa, ii) Senior ICT Managers was then able to go on to identify ways that are sensitive to our context from various National, Provincial four steps that need to be taken as a developing country on the and Local government entities, iii) by government decision makers in African continent that is nonetheless Thusong Service Centre Managers, order to make the implementation of striving to take advantage of the iv) Thusong Service Centre end- E-government in South Africa more enormous technological advances users and v) expert reviewers. This effective. These steps are a review of that characterise life today. The work stage of the study also involved the existing status of e-Government, not only aims to provide easier access reviewing documents including the the adoption of the framework, the to services but also demonstrates the National e-Government Strategy, the balancing of the development of commitment of UFH to enhancing the e-Government Policy, the National technological, organisational and lives of the communities in which it is Broadband Policy and the ICT Policy environmental characteristics in embedded witnessed so often in this White Paper. The analysis of all this order to prioritise future plans, and Research Report. data then allowed for a revision of the monitoring of e-Government the conceptual framework in order projects. to close the gap between theory and practice. The resulting revised framework identifies a number of areas key to the implementation of e-Government at Thusong Service Centres drawn from the Technology-Organisation- Environment model which informs the study: the organisational context, the environmental context and the technological context. Elements of the organisational context include the nature of senior leadership, the extent to which collaboration with other governmental entities is achieved and resistance to change. In the environmental context, the research identified political, economic, regulatory, cultural and social issues. The study identified ICT strategy and ICT infrastructure as Research Report 2021/2022 | 48

MANAGEMENT AND COMMERCE Pandemics and infodemics: the importance of providing trustworthy information Dr Charity Hove and Professor Liezel Cilliers uring the pandemic, social to inflict harm on another person, media users created and organisation or country. Dconsumed information about As we all know too well, during Covid-19 at a phenomenal pace. the pandemic, information about As they did this, they effectively prevention, cures, symptoms, the contributed to an ‘infodemic’, an origins of the virus and emergency overload of both accurate and measures put in place by governments inaccurate information conveyed was disseminated widely. Sadly, much digitally as well as through more of what was circulated was not true. traditional means of communication. Studies examining the sharing of According to Dr Charity Hove, information offer the potential of a postdoctoral researcher, and insights which can be used to better Professor Liezel Cilliers of the manage infodemics in the future. Department of Information Systems, This challenge of developing such an infodemic can result in an increase knowledge was eagerly taken up by in the number of people who distrust Fort Hare researchers, Dr Hove and the public health system, making Professor Cilliers. it difficult to manage a pandemic effectively. The aim of the study was to Dr Charity Hove The Covid-19 pandemic resulted in investigate how social listening tools, an overflow of health information an example of which is the World on social media, as many millions Health Organisation’s (WHO’s) Early of people across the world created, AI-supported Response with Social uploaded and shared content. listening tool (EARS), could contribute to the management of information Unfortunately, user-generated content is not verified before being about health during an infodemic. shared with others. This has the During pandemics, information ages potential to allow for disinformation, very quickly, so real-time, current, misinformation and malinformation. up to date information is important. Disinformation is where a user The EARS tool summarises real-time distributes information known to information and online Covid-19 be false. In contrast, misinformation conversations, making data available is information that is false, but to researchers for analysis. the person who is disseminating In South Africa, the National State of it believes that it is true. Lastly, Disaster introduced to try to manage malinformation is information that the pandemic finally came to an end is based on reality but which is used 49 | University of Fort Hare

MANAGEMENT AND COMMERCE became aware of a fifth wave and the link to the government’s information discovery of the Omicron XE variant site on the virus. Many social media in the United Kingdom. This single platforms such as Facebook also observation emerging from the study regulated the sharing of links in order stresses the need for the ongoing to try to control the spread of false monitoring of social media for mis- information. If we are to limit the and disinformation. alarm caused by false information, The study allowed the researchers to the reinforcement of regulations is make a number of recommendations, critical. one of which is that South Africa False information can be harmful should develop its own social media in so many ways. In the context of listening tool. A tool that can analyse a pandemic, amongst other things communications in all local languages it can result in people failing to take Professor Liezel Cilliers would allow for better tracking of precautions against contracting a information of all sorts and for disease, in the use of remedies that management of false information. A are actually harmful, and in a great second recommendation relates to deal of anxiety and worry on the part on 4 April 2022. The study conducted the need for trustworthy sources to of all citizens. Once again, Fort Hare by Dr Hove and Professor Cilliers be more visible and more accessible researchers have shown how the analysed trends on EARS in South to users. In 2020, a regulation was skills and expert knowledge of its staff Africa using content analysis over a introduced stating that all internet can contribute to the public good in month-long period after this date. sites with a .zaDNA top level domain South Africa and beyond. Immediately apparent was the fact needed to have a landing page with a that the volume of conversations increased by 1.1% after the end of the National State of Disaster was announced. One possible reason for this increase in volume could have been that people began to ask whether they were less likely to contract the virus two years after the start of the pandemic and, if so, whether the symptoms associated with it would be less serious. Needless to say, some argued that this had always been the case. Interestingly, the study also showed that the proportion rate of stigma associated with the virus decreased by only 0.1% following the announcement of the end of the State of Disaster. Misinformation and disinformation increased during the study period possibly as users Research Report 2021/2022 | 50

MANAGEMENT AND COMMERCE An alternative to the universities? Investigating service quality at TVET Colleges Professor Kim Viljoen and Professor Liezel Cilliers the Department of Higher Education circulation of a link to the survey over and Training for some years now. a period of six months resulted in In a speech made in June this year, 9,494 responses. The survey itself was the Minister of Higher Education based on adaptations of SERVQUAL, and Training, Dr Blade Nzimande, the most consistently and widely used demonstrated his awareness of this measure of service quality, frequently need by declaring his determination used in the context of education. to ‘grow the TVET section faster and The study then drew on descriptive enable subsidy and infrastructure statistics (using percentages and funding that can support its rapid means) to represent students’ student enrolment growth’. perceptions. What do students think of TVET Eighty percent of the students who Colleges though? In South Africa, responded to the survey reported Professor Kim Viljoen one of the main factors affecting being satisfied or very satisfied in students’ decisions as they leave responses exploring, amongst other school is employability and, as UFH things, lecturers’ friendliness, their n South Africa, an argument is researchers Professor Kim Viljoen knowledge and professionalism, often made that our post-schooling of the Department of Business processes related to registration, the competence and accessibility of education system needs reshaping. Management and Professor I In 2022, fewer than half a million Liezel Cilliers of the Department administrative staff, the standard of young people were enrolled in of Information Systems point out, work and course content, facilities on Technical and Vocational Education service quality (SQ) has been reported the campuses and campus location. and Training (TVET) colleges, while as influencing students’ perceptions Importantly, the study also explored more than a million were registered of employability. The two researchers’ students’ access and use of in the universities. In other countries, study into service quality at TVET technology, with Professors Viljoen the proportions in the different Colleges was therefore important, not and Cilliers discovering that 77% of all sectors are very different. In Germany, least because it offered the promise respondents owned a smartphone, long noted as one of the economic of producing recommendations that but only 9% had a laptop computer. success stories of Europe, a relatively could be used to improve service As many as 980 of the respondents small proportion of young people provision and make this sector of do not own any device on which go into the universities. Many more post-secondary education more they could learn online. Most school leavers enrol in a range of attractive to school leavers. respondents noted the high cost technical and vocational institutions Professors Viljoen and Cilliers used of data as an obstacle to online across the country. a survey to engage with all students learning, with many also indicating The need to reshape the post- over the age of 18 registered for study that connectivity was a problem. school system has been a focus of at the country’s 50 TVET Colleges. The However, overall students appeared 51 | University of Fort Hare

MANAGEMENT AND COMMERCE to view online learning positively, academic support structures, as One other of the many although only a third of respondents these could be offered and conducted recommendations focuses on the claimed to enjoy the online learning online. need for the colleges to provide more experience in 2020, and reported The two researchers also identified opportunities for social interaction needing more motivation, adequate the need to provide opportunities via clubs and societies on campus. support from the college, and more for students to access mobile Professors Viljoen and Cilliers point social interaction with the lecturer to devices and data by partnering with out that initiatives to improve social gain more from their online learning technology companies and providing interaction would not necessarily be experiences. discounted rates for students. The costly and could have an enormous access to data represents a very real impact on the way students feel about Recommendations made by themselves and college life. Professors Viljoen and Cilliers as a problem for TVET students and is result of their study include the need something that must be addressed. Once again, this study by Fort Hare to improve online learning facilities This would help them with their academics shows how research by providing a balance of face-to-face studies, in forming study groups, in conducted at the University has the and online learning interactions. If accessing the learning material from potential to make a real difference colleges provide more online support, wherever they are, and in connecting at so many levels. Improvements in more structure to the online learning to one another. Specifically, more TVET Colleges could make them much material, and more opportunities TVET students need to be provided more attractive to school leavers and for online ‘real time’ interactions, with laptops or tablets, as it is not an contribute to providing South Africa they could add significant value to ideal learning experience for students with the skilled workforce needed to the student learning experience. to use their mobile phones for study fulfil its economic potential. This would also address student purposes. dissatisfaction with additional Research Report 2021/2022 | 52

MANAGEMENT AND COMMERCE UFH-based accredited journal contributes to renewal of local government Professor Ogochukwu Nzewi hanks to the leadership of Editor- in-Chief, Professor Ogochukwu Nzewi of the Department of T Public Administration at the University of Fort Hare and other members of the editorial board, the Journal of Local Government Research and Innovation (JOLGRI), published in collaboration with AOSIS on an open access platform and accredited by the Department of Higher Education and Training (DHET), is making a mark in the academic arena by providing a forum for multidisciplinary research on local government in South Africa. The journal was established in January 2020 just as the world was about to be rocked by the Covid-19 pandemic. State President Cyril Ramaphosa had announced a three-week lockdown th on the 26 March 2020 and this was followed by the introduction of a package of measures including the recruitment, training and deployment of 28 000 health care workers and an economic stimulus package of more than R500 billion, about 10% of South Professor Ogochukwu Nzewi Africa’s Gross Domestic Product (GDP). The stimulus package was aimed at assisting the poor, businesses and, importantly, municipalities as they moved to address the challenges posed by the pandemic. 53 | University of Fort Hare

MANAGEMENT AND COMMERCE What is widely perceived as the to meet complex challenges and, Department of Public Administration dysfunction of local government has at the same time, make the most at UFH, argues that the struggle made headlines in South Africa for of opportunities for innovation identified in the rallying call of ‘aluta many years now with commentators represented an opportunity for a new continua’ cannot last forever. The citing capacity and skills deficits as journal as a forum for research. editorial then goes on to describe reasons for failures in service delivery. In 2021, JOLGRI was listed in the JOLGRI as a journal which seeks to When JOLGRI was established there Directory for Open Access Journals become a major player in scholarship was no indication that the world (DOAJ), an index approved by the and research on local government was about to witness a period of Department of Higher Education by developing a number of niche unprecedented disruption. An (DHET) for subsidy purposes. In an research areas. editorial written by Professor Nzewi in editorial entitled ‘Transformative UFH’s Strategic Plan, Towards a January 2020, entitled Re-envisioning networks and public participation in Decade of Renewal, 2022-2026, local government studies, research local government in the post COVID sets into motion a decade of new and practice for the future, reflected era’ written in the same year, Professor beginnings, fresh perspectives and on the potential of local government Nzewi noted how limitations on social good governance. Arguably, the same to best adopt practices and foster contact during the pandemic had kind of renewal is needed in local growth and innovation. However, affected the way local government, government in South Africa. However, as if predicting the near future, the the sphere of government closest to to re-envision local government as editorial also contemplated the ability the people, was able to interact with the globe recovers from COVID 19, of many local governments, given their the people it served. For Professor research must play a role and it is current state, to manage day to day Nzewi, Covid-19 had forced a ‘hard here that JOLGRI has an enormous responsibilities and, at the same time, shift in previously designed public contribution to make. As a DHET deal with any crises that might occur. participatory strategies’. accredited journal hosted by UFH, According to United Cities and Local JOLGRI is not only working towards Government, the largest organisation JOLGRI is the only accredited South contributing to the University’s of local and regional governments African journal focused on local decade of renewal but also to the in the world, local governments in government research and practice renewal of local government itself by developing nations struggle to attain and sees its role as becoming even encouraging and disseminating high the momentum needed to innovate more urgent in coming years. In its quality research. and offer alternative services in many 2022 editorial entitled ‘Aluta Continua: areas including the need to manage will it ever end? The reality of local spatial development in the context of government in practice’, Associate historical legacies and climate change. Editor Dr Tando Rulashe, of the The need for local governments Research Report 2021/2022 | 54

Legal Issues 55 | University of Fort Hare

Research Report 2021/2022 | 56

LEGAL ISSUES Free trade and the human right to food: The need to re- theorise and review international agricultural trade regulation Dr Shelton Mota Makore, Professor Patrick Osode and Dr Nombulelo Lubisi ver the last fifty years or so, countries. Despite these different For the three researchers, the trade across international points of view, the idea that liberalising ideological thinking underpinning Oborders has increasingly agricultural trade should comply with the liberalisation of agricultural been freed from constraints as a obligations related to the human trade is problematic on a number result of globalisation. However, right to food is gaining momentum of counts especially when evaluated concerns about food security have led in multilateral agricultural trade against the human right to food. to questioning of this liberalisation of negotiations. Their study therefore argues that trade especially in the context of the A study conducted by Dr Shelton the WTO needs to re-theorise and aftermath of the Covid-19 pandemic Mota Makore, postdoctoral fellow in reform its Agreement on Agriculture and the Russia-Ukraine war. The the Faculty of Law, Professor Patrick and, in doing so, pay attention to interruption of food supply chains Osode of the Faculty of Law and Dr whether continued adherence to the has undermined the realisation of Nombulelo Lubisi, also of the Faculty established international law principle the human right to food and the need of Law, argues that current rules of lex specialis, or the idea that more to ensure access to nutrition for the for the regulation of trade are not specific rules should prevail over poor is now more urgent than ever. supportive of the realisation of the general rules, is appropriate as the human right to food especially in promotion and protection of human Nonetheless, supporters of rights is one of the most important free trade maintain that the developing countries. In making this goals of contemporary international current regulatory framework for argument, the three researchers law. The framing of WTO rules (set out question the set of principles and international agricultural trade in the Agreement on Agriculture) in a improves the accessibility, availability, beliefs underlying the existing way that undermines the human right and affordability of food to the regulatory framework. to food and food security therefore world’s population. Some human The study itself drew on a literature creates the compelling need to re- rights scholars and other academic review involving a critical examination think those rules from a perspective commentators, on the other hand, of pertinent legal instruments and that prioritises state compliance with maintain that the current World scholarly writings. The review of the obligations arising from the human Trade Organisation’s (WTO) model of literature was conducted in order to right to food. liberalisation-based governance for demonstrate the need for the WTO agricultural trade exacerbates global to consider non-trade concerns, the The human right to food is not the hunger, rural underdevelopment most important of which involves the only reason for the need to review and contributes to environmental human right to food. WTO rules identified by the three degradation, especially in developing researchers, however. A reform of 57 | University of Fort Hare

LEGAL ISSUES pertinent global trade law rules would Reference: also benefit small-scale farmers Mota, S., Osode. P. & Lubisi, N. In and people living in rural areas who press. ‘Re-theorising international are affected by agricultural trade agricultural trade regulation to liberalisation. realise the human right to food in Once again, another study by developing countries.’ Journal for University of Fort Hare researchers Juridical Science. demonstrates a commitment not only to the rigorous production of knowledge but also the goal of using knowledge to contribute to greater equality. Research Report 2021/2022 | 58

LEGAL ISSUES The role of the judiciary in achieving the goals of the 2030 Agenda for Sustainable Development in South Africa Professor Ntlama-Makhanya ll South Africans remember 1994, the year of the first democratic election, Aas a year of dramatic change. For Professor Ntlama-Makhanya, Professor of Public Law in the Nelson Mandela School of Law, however, it was the adoption of the Constitution in 1996 that marked the date when South Africa finally began to carve out a new identity for itself. The Constitution set out the values on which the new democratic order was to be based, values such as freedom, equality and dignity. However, as Justice Pius Langa, South Africa’s Chief Justice and head of the Constitutional Court from 2005 until his retirement in 2009, points out, ‘What the Constitution proclaims … is one thing. What really matters to the women, men and children of our country is the reality of change and how the constitutional prescripts manifest themselves in their lives’. For Professor Ntlama-Makhanya, this means that the role of the judiciary, and the Constitutional Court in particular, is key to ensuring that all South Africans do indeed benefit from the values enshrined in the Professor Ntlama-Makhanya 59 | University of Fort Hare

LEGAL ISSUES Constitution. She cites the case of For Professor Ntlama-Makhanya, Professor Ntlama-Makhaya’s research Harksen v Lane as an example of this however, the role of the judiciary goes explores the role of the judiciary as a process. The Harksen v Lane case beyond the borders of South Africa, a model for the achievement of the goals focused on the Insolvency Act and a point taken up in her latest research. of the 2030 Agenda for Sustainable section protecting the rights given The United Nations Organisation’s Development in South Africa. In doing by a man to his wife or a child born (UNO’s) 2030 Agenda on Sustainable this, she shows other countries how of their marriage in an antenuptial Development is described by the functioning of the judiciary in a contract (ANC) from being set aside the UNO as a ‘plan of action for constitutional democracy can be a during sequestration. As it stood, people, planet and prosperity’. The model for other countries. Looking the section of the Act appeared to implementation of the Agenda is a locally and globally at the same time discriminate against certain groups cross-national project requiring the is a feature of much of the research of people. A wife could keep benefits development of a common identity featured in this report. Once again we given to her under an ANC, but gifts based on human rights. The intention see another UFH researcher making given by a wife to a man could be set of this global project is to eliminate these connections to take knowledge aside. The judgement in the Harksen all forms of systemic inequality and forward. v Lane case addressed this inequality discrimination in order to create and thus ensured that society was a society that is based on values able to draw on the value of equality enshrined, at a domestic level, in the enshrined in the Constitution. South African Constitution. Research Report 2021/2022 | 60

LEGAL ISSUES Two heads are better than one: Assessing South Africa’s ‘twin-peaks’ financial regulation model Professor Patrick Osode he Financial Sector Regulation One problem identified by Professor head of the National Treasury) is Act (FSRA) was signed into law Osode relates to a section of vested with the power to remove in August 2017. This event saw the FSRA that requires the PA to the FSCA Commissioner from office. T South Africa joining a short list of support sustainable competition in Given that the Minster is a political countries that have switched to a ‘twin the provision of financial products appointee, the way is left open for peaks’ model of financial regulation. and related services. According to political interference. Professor The ‘twin peaks’ model involves Professor Osode, this clearly leaves Osode argues that international best regulatory jurisdiction over financial space for the PA to undertake its practice and the academic literature services players (banks, insurance mandate of promoting competition draw on the need for financial sector companies, pensions administrators without the consent, support and/ regulatory agency heads, such and so on) now being exercised by or collaboration of the Competition as the FSCA Commissioner, to be immune from political interference two separate, independent agencies: Commission, something which the Prudential Authority (PA), part of would clearly be desirable given the and manipulation. As the FSRA the administrative structure of the importance of alignment and synergy already makes the FSCA accountable South African Reserve Bank, and the between competition promotion to Parliament, vesting the power Financial Sector Conduct Authority initiatives as well as the very real both to appoint and remove the (FSCA), a reincarnation of the former prospect of regulatory turf protection. FSCA Commissioner in the Finance Financial Services Board. Another problem for Professor Minister in order to further secure UFH researcher Professor Patrick Osode relates to the role and accountability to the government of Osode’s study of the ‘twin peaks’ model powers allocated to the Minister of the day is problematic. Depending resulted in an article published in the Finance to hire and fire the PA’s Chief on how it is configured, and although Interdisciplinary Journal of Economics Executive Officer as this raises the accountability to Parliament and Business Law. The article seeks to possibility of political interference in alone could occasionally result in understand the rationale behind the the functioning of the PA itself. For the FSCA’s paralysis because of adoption of the ‘twin peaks’ model Professor Osode, this represents deadlocks, Parliamentary oversight by South Africa and then assesses its a failure, on the part of lawmakers, would protect the FSCA from being fitness for the purposes intended by to ensure the PA’s immunity from ‘captured’ by powerful political and those responsible for its adoption in political interference and is a design private interests. this country. In the article, Professor flaw in the South African ‘twin peaks’ Important in the FSRA is that one of Osode comes to the conclusion that, model. the few mandates given to the FSCA is although the design of the model is The potential for political interference the responsibility to promote financial fundamentally sound, some aspects is also highlighted in the fact that inclusion, something which is clearly are flawed. the Finance Minister (as political very important in a country such as South Africa where divides between 61 | University of Fort Hare

LEGAL ISSUES Professor Patrick Osode the ‘haves’ and the ‘have nots’ are so Osode comes to the conclusion that round of financial services law reform stark. However, the means by which other countries could learn from would do well to take heed of his financial inclusion would be achieved South Africa’s implementation of the perspicacity. were only beginning to emerge in ‘twin peaks’ model. Professor Osode Reference: 2020, three years after the FSRA cites Australia’s recent Hayne Report became part of national legislation. In which looked into misconduct in Osode, P. 2021. ‘Two heads are spite of this, the success of the FSCA the banking, pension and financial better than one: Assessing South in delivering on its closely related services industry noting that Australia Africa’s ‘twin peaks’ financial mandate to design and deliver could learn from the design of model. Interdisciplinary Journal of financial education programmes for South Africa’s ‘twin peaks’ regulatory Economics and Business Law, 10: current and future financial service architecture. 0-32 consumers as well as the general In turning a critical eye to the public has already shown the potential implementation of the ‘twin peaks’ to impact on financial inclusion in the model in South Africa, Professor country. Osode once again shows how the In spite of being able to identify expertise and insight of Fort Hare problems with the implementation of researchers have much to offer the the model in South Africa, Professor country. Those involved in the next Research Report 2021/2022 | 62

LEGAL ISSUES Company law and investor confidence: Analysing Zimbabwe’s new Companies and Other Business Entities Act Professor Patrick Osode and Dr Friedrich Hamadziripi or many, company law is of are unable or unwilling to do so. action. concern only to commercial The term ‘derivative’ arises because For Professor Osode and Dr lawyers or students doing a an individual, usually a minority F degree in commerce. However, shareholder, steps into the shoes of Hamadziripi, the design of a system as Professor Patrick Osode and Dr the company to seek redress on its for derivative action needs to balance Friedrich Hamadziripi, his former behalf. The individual will not receive the need for directors of a company doctoral student who is now a post- direct benefit from the court order to be able to exercise authority and, at doctoral fellow at the North-West being sought. Rather it is the company the same time, be accountable. They University, argue, company law that will receive the benefit although also identify the need for the interests can have implications for anyone shareholders may eventually derive of the company to be balanced concerned about everyday things like some benefit if the wrong identified in alongside those of its shareholders. the cost of living and employment the action is addressed. A system for derivative action that as sound law can increase investor The primary function of derivative favours shareholders is open to confidence at a national level and so abuse and can result in interference lead to economic development. proceedings is to ensure accountability on the part of directors in the management of the company. Professor Osode and Dr Friedrich of a company. The possibility of It may also discourage directors Hamadziripi’s interest is in the derivative action therefore functions from entrepreneurial risk-taking and derivative action, a type of lawsuit that as a kind of ‘watchdog’ on the actions undermine efficiency of the business. allows an individual or stakeholder of directors and is seen as part of On the other hand, an ineffective to institute legal action on behalf of good corporate governance which is system for derivative action has the a company to protect the interests attractive to investors. potential to protect errant directors of that company. As a company is a and decrease investor confidence. legal entity in its own right, it is usually In Zimbabwe, the new Companies Professor Osode and Dr Hamadziripi’s the company that must institute legal and Other Business Entities (COBE) analysis is that, in developing actions to address any wrongs against Act introduces the derivative action the COBE Act, the Zimbabwean it. However, in certain circumstances, into Zimbabwean company law. A legislature borrowed freely from the some countries allow individuals recent article written by Professor contemporaneous ownership rule in to bring a derivative action lawsuit Osode and Dr Hamadziripi in the the United States of America. This rule provided they are shareholders in the Journal of African Law, published by is not part of the system for derivative company at the time of the incident the University of Cambridge Press action in the United Kingdom (UK) or that gave rise to the concern leading on behalf of the School of Oriental South Africa (SA). In Zimbabwe, this to the suit itself. A derivative action and African Studies (SOAS) of the means that the only stakeholders is usually brought before the court University of London, assesses some who can institute derivative litigation when the directors of a company major weaknesses in the way the are those who hold at least 10% of COBE Act allows for the derivative 63 | University of Fort Hare

LEGAL ISSUES a company’s shares at the time the alleged misconduct took place. This makes the system for derivative action in Zimbabwe one of the most restrictive in the world. In South Africa, virtually any stakeholder has the right to pursue derivative action. Existing share ownership patterns in Zimbabwe mean that the 10% threshold is difficult to achieve. According to Professor Osode and Dr Hamadziripi, this means that the COBE Act runs the risk of limiting shareholders’ access to justice and, thus, fails in promoting the accountability of directors and managers. A strike suit is a lawsuit of In order to institute a derivative Zimbabwe leads both researchers to questionable merit brought in order suit, complainants must demand recommend that the Act should be to arrive at a private settlement that a board of directors reverse a reviewed and amended. before a case reaches court, possibly course of action being disputed or because settling out of court would show that making such a demand This publication in a prestigious cost less than a defendant’s legal of the board would have been futile. journal shows how careful analysis costs. At the time the COBE Act was This rule is known as the ‘demand of a law, in this case one enacted in adopted, the threat of strike suits requirement’. Another criticism of a neighbouring country, could have was relatively high. According to the COBE Act identified by Professor the potential to impact on the lives Professor Osode and Dr Hamadziripi, Osode and Dr Hamadziripi relates to of millions of people if it succeeds in this is no longer the case in spite the expectation that the Zimbabwean promoting a review of legislation to of the fact that some incentives legislature should have provided ensure sound corporate governance for mischievous shareholders to more guidance about the response a and enhance investor confidence engage in litigation with the hope of company can make to a demand from and is yet another instance of UFH concluding a settlement still remain. shareholders to reverse a course research making a difference at an Although the threat of strike suits of action. In the opinion of the two international level. could provide a reason for the rule researchers, the new Act falls short requiring potential litigants to have Reference: a minimum shareholding of 10%, the on detail and needs to be amended threat of strike suits is no longer high immediately to address this problem. Hamadziripi, F. & Osode. P. making the rule itself questionable in One aspect identified as lacking more 2022. ‘A critical assessment of the researchers’ eyes. specifically is guidance as to whether, pertinent locus standi features upon receipt of the demand, a of the derivative remedy under In addition, the new COBE Act does not company can apply to a court to set Zimbabwe’s new Companies and cover cases of directorial negligence, the demand aside if it lacks merit. Other Business Entities Act.’ Journal proposed acts or omissions by of African Law, 66(2):315-338. management and litigation against The points described above are just third parties. It can only be hoped that some of the problems identified in the Zimbabwean courts will adopt a the COBE Act by Professor Osode flexible approach to interpreting the and Dr Hamadziripi. Analysis of the Act to cover such cases. provisions for derivative action in Research Report 2021/2022 | 64

LEGAL ISSUES Getting to school and the right to basic education Dr Siyabulela Fobosi eographically, South Africa is Learners’ access to school transport a vast country. Its history and during the Covid-19 pandemic Gthe fact that many learners live emerged as a concern for Dr in deeply rural areas mean that many Siyabulela Fobosi, senior researcher children have to travel long distances and acting head of the UNESCO to get to school. As a result, learners’ Oliver Tambo Chair of Human Rights access to scholar transport is critical in the Faculty of Law. During the early to their ability to access education. lockdowns, schools were closed. As Dr Siyabulela Fobosi The National Land Transport Policy restrictions eased, schools reopened (NLTP) was created in conjunction with and the matter of transport became the Department of Basic Education important. Unlike other countries in and several stakeholders in order to the developed world, South Africa address concerns related to the ability was not necessarily able to implement of learners to access safe transport to some of the measures used to limit school. The policy establishes minimal infection adopted in richer countries. norms and requirements for the In some countries, occupancy of provision of learner transportation. vehicles was reduced and regular Responsibility for scholar transport cleaning schedules were introduced. is divided between provincial and In Norway, the recommendation was national departments of education. that learners should avoid school Learners deemed to be in need of transport and families should rather transportation are identified by the use their own vehicles to convey provincial education department. children to school. Needy learners in Grades R and Dr Fobosi’s concern with access to One are prioritised . Students with transport, and thus to basic education, disabilities must be transported and led him to conduct a study based on the policy provides for no provision a rights-based approach in order to for carrying learners to school in areas investigate access to school transport where public services are available. in the Amathole West district in the Unfortunately, the implementation Eastern Cape. The study drew on a of the policy has been delayed due survey as well as observations and to issues related to finance and the documentary research. Participants allocation of accountability. in the study included eight educators and 160 learners from two primary 65 | University of Fort Hare

LEGAL ISSUES and two secondary schools. The In a submission to the Standing majority of learners and teachers Committee on Appropriations in 2017, surveyed were female. Equal Education, a membership- The survey questioned learners’ based movement of learners, satisfaction with the location of the parents, teachers and community schools they attended, with only members, noted that ‘the lack of 16% noting they were dissatisfied. adequate and sufficient scholar However, 61% of the learners surveyed transport cripples a learner’s ability to travel 10 kilometres from home to access schooling, and consequently school, with 26% indicating that they violates many South African learners’ travelled more than 20 kilometres, constitutionally protected right to a thus demonstrating that learners basic education’. Dr Fobosi’s study rely on scholar transport to exercise of Amathole West validates this the right to access basic education. observation by identifying the high These findings indicate that scholar proportion of learners’ long distances transport plays an important role in from schools, and so identifies the ensuring the realisation of the right to need for the NLTP to be implemented access basic education. as soon as possible if learners’ rights are to be realised. Research Report 2021/2022 | 66

67 | University of Fort Hare

Vice Chancellor’s Research Awards Research Report 2021/2022 | 68

VICE CHANCELLOR’S RESEARCH AWARDS VC’S SENIOR RESEARCHER AWARDS OVERALL WINNER: Professor Blessing Aderibigbe Professor Blessing Aderibigbe of the Department of Chemistry is an organic/ polymer chemist with a special interest in the design of systems for multi-drug delivery and polymer-based wound dressings loaded with plant-based extracts and essential oils. The goal of her current research is to design hybrid molecules for targeted drug delivery which have reduced toxic effects. Rated C2 by the National Research Foundation (NRF), Professor Aderibigbe’s research has resulted in contributions to no fewer than 87 journal articles and 42 book chapters, in many cases as lead author. She has also participated in conferences held nationally and internationally, travelling to places as diverse as Kerala in India and New Orleans in the United States in order to do so. Professor Aderibigbe has been the recipient of two NRF postdoctoral fellowships and, in 2007, received a special award from the Parenteral Drug Association, an organisation devoted to providing information to the pharmaceutical and biopharmaceutical community. Professor Blessing Aderibigbe One of her current research projects, involving collaboration with colleagues from the Council for Scientific and Industrial Research (CSIR) and the University of the Witwatersrand, is funded by the Department of Trade, Industry and Competition’s Technology and Human Resources for Industry Programme (THRIP). 69 | University of Fort Hare

VICE CHANCELLOR’S RESEARCH AWARDS FACULTY OF SOCIAL SCIENCES AND HUMANITIES WINNER: Professor Pius Tanga Professor Pius Tanga, Deputy Dean for Research and Internationalisation in the Faculty of Social Sciences and Humanities, completed his professional training as a social worker in Yaounde, Cameroon and in Nigeria. He has taught at universities in Cameroon and at the University of KwaZulu-Natal here in South Africa. He has been at the University of Fort Hare (UFH) since 2009. Professor Tanga’s research interests include social justice and social protection for children and families, and social work education in Africa. He has conducted development- oriented research for bilateral and multilateral donors and humanitarian agencies such as the European Union, SOS, the Kellogg Foundation, the International Development Research Centre (IDRC), based in Canada, and the United Nations Children’s Fund Professor Pius Tanga (UNICEF). In addition, he has over a hundred academic publications South Africa. Professor Tanga added In addition, Professor Tanga has in the form of journal articles, book to his qualifications with a Master extensive experience as an examiner, chapters / books, and research / of Arts degree in Human Rights and having assessed 97 Master’s technical reports. He is a member a Postgraduate Diploma in Higher dissertations and 37 doctoral theses of the editorial board of one South Education and Training at UFH. for universities in both South Africa African journal and two international and further afield. He is rated C3 by journals. In 2009, he was the recipient of the the NRF and is currently co-editing a Professor Tanga holds a Diploma Vice Chancellor’s Research Award at Routledge Handbook of African Social in Social Work from the National the National University of Lesotho and Work Education. School for Social Workers, Yaoundé, received the Vice Chancellor’s Senior Cameroon; a Bachelor of Social Researcher Award for the Faculty of Work / Community Development Social Sciences and Humanities at degree from the University of UFH in 2014, 2019 and 2021. To date, Nigeria, Nsukka with honours in the Professor Tanga has supervised 38 Upper Class Division; and a Master full research Master’s degrees and 23 of Social Work degree from the doctoral degrees to completion. He University of Ibadan, Nigeria. He has also supervised four postdoctoral then completed his doctoral studies fellows and hosted three National at the University of KwaZulu-Natal in Research Foundation (NRF) interns. Research Report 2021/2022 | 70

VICE CHANCELLOR’S RESEARCH AWARDS FACULTY OF LAW WINNER: Professor Nomthandazo P Ntlama-Makhanya Professor Nomthandazo Ntlama-Makhanya is Professor of Public Law in the Department of Public Law at the Nelson R Mandela School of Law at the University of Fort Hare (UFH). She has also occupied the position of Head of Research in the School of Law and acted as Head and Chairholder of the UNESCO ‘Oliver Tambo’ Chair of Human Rights at UFH. Professor Ntlama-Makhanya’s professional accomplishments include time spent as a Commissioner of the South African Judicial Services Commission (JSC), a position in which she represented the Society of Law Teachers of Southern Africa. She has also acted as a Judge of the High Court in both the Bhisho (Eastern Cape) and Durban (KwaZulu-Natal) divisions. She is currently a Member of the South African Electoral Court and acted as a judge at the Makhanda High Court in the Eastern Cape for a four-week period in August / September of this year. Professor Ntlama-Makhanya’s research has resulted in the publication of many academic articles, book chapters and articles in newsletters. She has participated in numerous national and international conferences and has vast experience of supervising and examining at both Master’s and doctoral levels. Her research has resulted in a C3 rating from the National Research Foundation (NRF). As a result of appointments as an acting judge, Professor Ntlama-Makhanya has produced legal judgments. She has also provided legal opinions on matters before the Courts. Her speciality is Constitutional Law, an area that covers broad topics Professor Nomthandazo Ntlama-Makhanya on human rights, customary law, gender equality, socio-economic rights, judiciary and state institutions. She serves on the editorial boards of a number of academic and legal journals. Professor Ntlama-Makhanya’s accomplishments are not only academic. She is a retired national and international netballer, having represented South Africa in competitions held in various countries. Her legal background and talent as a sportsperson come together in her current role as National Chairperson of the Disciplinary Appeals Committee for Netball South Africa. Professor Ntlama-Makhanya’s love of sport is not limited to netball, however, an observation evidenced by her role as Deputy President of King Central and District Rugby Union, an affiliate of Buffalo City Metropolitan Municipality District Rugby Union, with the latter District being an affiliate of Border Rugby Union. She is also Life-term President of her home team, the Jungle Lion Sports Club. 71 | University of Fort Hare

VICE CHANCELLOR’S RESEARCH AWARDS VC’S EMERGING RESEARCHER AWARDS OVERALL WINNER: Dr Nomzamo Dube Dr Nomzamo Dube is currently attached to the University of Fort Hare’s Centre for Transdisciplinary Studies as an Academic Coordinator. She holds a Bachelor in Applied Communication Management degree and Bachelor and Master of Social Science degrees in Communication, all from the University of Fort Hare. She also gained a Post Graduate Diploma in Higher Education and Training (PGDHET) from UFH. Dr Dube moved to Nelson Mandela University for her doctoral studies and attained the degree of Doctor of Philosophy (PhD) in 2019. Dr Dube is currently leading a research project on the experiences of both students and staff in the higher education system and is working on a book project on violent student protests at universities. Her research interests include social and broadcast media and studies on Kalanga, the third most spoken language in Zimbawe. Dr Dube published her debut novel ‘Milk, bile and honey’ in 2020, which was shortlisted for the National Institute of Humanities and Social Science’s Fiction Dr Nomzamo Dube Award in 2021. Research Report 2021/2022 | 72

VICE CHANCELLOR’S RESEARCH AWARDS FACULTY OF MANAGEMENT AND COMMERCE WINNER: Dr Palesa Makhetha-Kosi Dr Palesa Makhetha-Kosi has fourteen years’ experience as a lecturer in the Department of Economics at the University of Fort Hare (UFH) and has served as Head of the Department for the last eight years. She has been a coordinator for the Extended Curriculum Programme in the Faculty of Management and Commerce since 2010 and also for the BCom honours programme funded by the Bank SETA since 2017. Dr Makhetha- Kosi has a passion for mentoring young academics, and took this up actively in her leadership of the Department of Economics. Her work providing guidance to younger members of staff has paid off as 90% of staff members have been developed within the Department, a remarkable example of the philosophy of ‘growing one’s own timber’. Dr Palesa Makhetha-Kosi holds a Doctor of Commerce degree in Economics from the Nelson Mandela University and a Master of Commerce degree in Economics from UFH. To date, she has acted as sole supervisor of ten Master’s degrees and as co-supervisor for another five. In addition, she has supervised 61 honours students. Dr Palesa Makhetha-Kosi Her current supervision load includes nine Master’s students and one doctoral study, work that is performed in addition to that of coordinating postgraduate studies within the Department overall. She has been involved in several research initiatives including a project conducted for the Eastern Cape Provincial Treasury and the National Department of Employment and Labour. As a result of a partnership that she secured between the University and the Department of Employment and Labour, Dr Makhetha-Kosi is the South African representative on the BRICS Research Network for Labour. She is currently working on two papers resulting from her doctoral thesis, a paper in the field of teaching and learning and another collaborative paper on inclusive growth and financial exclusion. Her research interests include banking, labour economics, and economic development. VC’S INNOVATION AWARDS 73 | University of Fort Hare

VICE CHANCELLOR’S RESEARCH AWARDS MOST INNOVATIVE PROTOTYPE DEVELOPED MEDAL WINNER: Professor Edson L. Meyer and Dr Olufemi Olayiwola Professor Edson L. Meyer, Director of the University of Fort Hare’s Institute of Technology, has been actively involved in renewable energy research for 26 years. His skills and expertise in semiconductor device physics, inorganic material chemistry, solid state physics and novel material characterisation, solar cells, modules and systems, solar energy yield studies, building integrated photovoltaics, and solar resource assessment have resulted in the award of a C rating by the National Research Foundation (NRF). Professor Meyer has been part of the Energy Research Programme in South Africa since 2006. His own research group is part of the Photovoltaic Spoke funded by the national Department of Science and Innovation. In addition, he has been the lead investigator in Professor Edson L. Meyer (Left) and Dr Olufemi Olayiwola (Right) a long-term contract with the national utility Eskom for measurement and of the Fort Hare Institute of research work is complemented verification of energy conservation Technology contributing to research by his experience of working for initiatives in the domestic, commercial on solar photovoltaic applications several years in the solar photovoltaic and industrial sectors. Through and smart energy systems. His skills industry in Nigeria and South Africa. his strategic research endeavours, and expertise lie in renewable energy Professor Meyer has worked with Dr Olayiwola holds a Bachelor of more than 75 postdoctoral fellows, technologies, solar photovoltaic applications and devices, device Science degree in Physics (Hons.), and doctoral and master’s graduates, and physics, semiconductor materials, a Master of Science degree in Electrical has produced more than 300 research power electronics, electrical and and Electronics Engineering, and was articles, contributions to conference awarded his Doctor of Philosophy proceedings, and technical reports. electrochemical systems, digital technologies and artificial intelligence. degree in Electrical Engineering from Professor Meyer received his doctoral He has published in various the University of Cape Town. degree in physics from the University international high-impact journals of Port Elizabeth in 2002. devoted to electrical and electronic Dr Olufemi I. Olayiwola is a member engineering and serves as a reviewer in the same area. Dr Olayiwola’s PRE-COMMERCIALIZATION INNOVATION PRODUCT, SERVICE OR PROCESS DEVELOPED MEDAL WINNER: Professor Edson L. Meyer and Dr Olufemi I. Olayiwola Research Report 2021/2022 | 74

VICE CHANCELLOR’S RESEARCH AWARDS NEWLY NRF-RATED RESEARCHERS Professor Forget Mingiri Kapingura Faculty of Management and commerce Department: Economics NRF Rating category: C3 Professor Forget Mingiri Kapingura holds a Doctor of Philosophy degree in Economics from the University of Fort Hare (UFH). His research interests are in Development Economics with a special focus on the role of the financial sector in the economy. He is a member of the Editorial Board of the Sriwijaya International Journal of Dynamic Economics and Business. Professor Kapingura was the recipient of the Emerging Researcher Award at both Faculty and Institutional level in 2017. Professor Nomthandazo Ntlama-Makhanya Faculty of Law Faculty Department: Public Law NRF Rating category: C3 Professor Ntlama-Makhanya is Professor of Public Law in the Nelson Mandela School of Law. Previously Head of Research in the School of Law, she also acted as Chairholder of the UNESCO ‘Oliver Tambo’ Chair of Human Rights. Professor Ntlama-Makhana is a former Commissioner of the South African Judicial Services Commission (JSC) and has acted as a judge of the High Court. Her research focuses on Constitutional Law and she has published on various topics related to human rights, customary law, gender equality, socio-economic rights and the judiciary and state institutions. Professor Ntlama-Makhanya holds a Doctor of Laws degree awarded by the University of Fort Hare. Professor Golden Makaka Faculty of Science and Agriculture Department: Physics NRF Rating category: C2 Professor Golden Makaka has more than 25 years of experience as a researcher in computational physics research and renewable energy applications. His research focus is in using computational physics in energy system design, simulation and modelling, heat transfer, temperature distribution and ventilation rate in buildings, and predicating energy consumption. He has been instrumental in developing techniques to mitigate climate change through smart power generation and his research has resulted in the design of a high efficiency, easy to maintain generator. Professor Makaka holds a Doctor of Philosophy degree awarded by the University of Fort Hare. 75 | University of Fort Hare

VICE CHANCELLOR’S RESEARCH AWARDS Professor Liezel Cilliers Faculty of Management and Commerce Department: Information Systems NRF Rating category: C3 Professor Liezel Cilliers’ research interests focus on electronic health with specific reference to electronic health records, health applications and health information found on social media. Her research on information disseminated using social media during Covid-19 pandemic, much of which was misleading or even false, has resulted in ‘infodemics’ becoming a major research focus for the future. Professor Cilliers is currently the Acting Dean of Management and Commerce. Originally qualified as a physiotherapist, Professor Cilliers was Head of the Department of Physiotherapy at both both Frere and Cecilia Makiwane hospitals before taking up a position in the Department of Information Systems at the University of Fort Hare (UFH). Her doctoral degree in Information Systems was awarded by Fort Hare in 2014. Professor Leon van Niekerk Faculty of Health Sciences Department of Human Movement Science NRF Rating category: C2 Prof. Leon van Niekerk completed his PhD in Psychology (2006) at the University of Johannesburg and a European Masters in Sport and Exercise Psychology (2007) at the Catholic University in Leuven, Belgium. He is a registered Counselling Psychologist and specializes in Sport Psychology. He assisted numerous national and International athletes in sports such as golf, squash, football, rugby, Olympic- and Paralympic athletes, swimmers, cricket players and teams such as our national life-saving teams, national acro-tumbling team, SA Proteas netball team, Bafana-Bafana, Lions u/18 team, and sports teams of numerous schools, universities and clubs since 2000. Prof Leon teach Sport Psychology and Research Methodology to undergraduate and post-graduate students in HMS since 2015 at the University of Fort Hare. He published numerous peer reviewed articles in national and international journals and wrote various chapters in academic books. His current research interests are in the psychological well-being of athletes, including topics such as sexual abuse in sport, the development of mental toughness, the development of sport identity and life roles, burnout, stress and anxiety among athletes, the effectiveness of mindfulness during competition, mental health in sport and the psychological health benefits of exercise. Dr Yeshona Sukai Fort Hare Institute of Technology NRF Rating category: Y2 Dr. Yeshona Sukai is a senior researcher in the Bioenergy Research Group at the Fort Hare Institute of Technology. Her research focuses on industrial waste valorisation for the production of biofuels and bioproducts using microbial fermentation processes. Before joining the University of Fort Hare, Dr Sukai was a postdoctoral fellow in the Microbiology and Chemical Engineering Departments at the University of KwaZulu- Natal (UKZN) where she also completed her Bachelor of Science, Master of Science and doctoral degrees. Research Report 2021/2022 | 76

VICE CHANCELLOR’S RESEARCH AWARDS Professor Oluyinka Osunkunle Faculty of Social science and Humanities Department: Communication NRF Rating category: C2 Professor Oluyinka Osunkunle is an Associate Professor in the Department of Communication in the Faculty of Social Science and Humanities. His main research interest is in Development Communication, especially community media and the development of social media efficacies. Other research areas include stakeholder relations, political communication and cultural studies. In 2017, Professor Osunkunle was awarded the Vice Chancellor’s Research Excellence Award in the Senior Researcher Category for the Faculty of Social Science and Humanities. Professor Osunkunle’s doctoral degree was awarded by the University of Fort Hare. Dr Chioneso Show Marange Faculty of Management and Commerce Department: Statistics NRF Rating category : Y2 Dr Chioneso Marange is a senior lecturer in the Department of Statistics. He is registered as a Professional Natural Scientist (Pr.Sci.Nat.) in the field of mathematical sciences with the South African Council for Natural Scientific Professions (SACNASP) and is affiliated as a Chartered Statistician in the field of statistical sciences with the Institute for Practicing Statisticians (ICCSSA). Dr Marange’s main research focus is on the development of empirical likelihood based testing and estimation procedures and has involved collaboration with academics both in South Africa and overseas. It covers topics including health promotion, drug and alcohol abuse, sexual risk reduction, HIV treatment and prevention methods and physical activity. His doctoral degree in Biostatistics was awarded by the University of Fort Hare in 2019. Dr Shylet Yvonne Chivanga Faculty of Management and Commerce Department: Development Studies NRF Rating category: Y2 Dr Shylet Yvonne Chivanga is a postdoctoral research fellow in the Department of Development Studies. Her main research interests lie in social policy and rural and international development. She participated in the Water Research Commission of South Africa’s Student Capacity Development Programme and, in this role, served as a research assistant in a study investigating the role of communities as water service intermediaries in the Eastern Cape and the Free State. Dr Chivanga also contributed to a project aimed at building capacity in the Mnquma Local Municipality conducted by the Department of Development Studies. Dr Chivanga holds a doctoral degrees in Development Studies awarded by the University of Fort Hare. 77 | University of Fort Hare

VICE CHANCELLOR’S RESEARCH AWARDS Professor Ikechukwu (Ike) Umejesi Faculty of Social Science and Humanities Department: Sociology/Anthropology NRF Rating category: C2 Professor Ikechukwu Umejesi is a multidisciplinary scholar with research interests in land use and natural resource extraction and the conflicts and exploitation that can arise as a result. He has also published on gender-related issues including domestic violence. In 2009 Professor Umejesi was awarded a fellowship by the Young Scientist Programme hosted by the International Institute for Applied Systems Applications (IIASA) in Austria, one of only two fellows from Africa that year. Since then, he has been involved in a number of international projects, often as principal investigator/ grant holder. Prof Umejesi has also produced two literary works in poetry and fiction. He holds qualifications from universities in South Africa, Nigeria, Austria and Poland including a Doctor of Philosophy degree from the University of Fort Hare. Dr Leocadia Zhou Faculty of Science and Agriculture Department: Risk and Vulnerability Science Centre (RVSC) NRF Rating category: C3 Rating Dr Leocadia Zhou is Director of the UFH Risk and Vulnerability Science Centre (RVSC) in the Faculty of Science & Agriculture. Her research activities focus on climate change related studies with an emphasis on water, energy, food security, vulnerability and adaptation. She is currently involved in six collaborative research projects involving stakeholders from a number of different entities including universities in South Africa, the Netherlands and Belgium as well as the Department of the Environment, Forestry and. Fisheries and the Water Research Council. Dr Zhou holds a doctoral degree in Geography and Environmental Science awarded by the University of Fort Hare. Dr Gloria Aderonke Otunola Faculty of Science and Agriculture Department: Biochemistry NRF Rating Category: C2 Dr Gloria Aderonke Otunola is a senior research fellow and co-leader of the Medicinal Plants and Economic Development Research Niche Area (MPED-RNA). Her research focuses on applied nutritional, biochemical and pharmacological evaluation. She is currently involved in research formulating functional foods, beverages and nutraceuticals targeted at specific chronic diseases. Products developed as a result of her research are currently being tested for acceptability and efficacy and intellectual property (IP) rights and patenting. Dr Otunula is also involved in research on the development and functionality of bio-nanoparticles in in delivering bioactive compounds into target organs to combat diseases such as cancer. Dr Otunola a doctoral degree from the University of Ilorin in Nigeria. Research Report 2021/2022 | 78

Acknowledgements The Research and Innovation Office is very grateful to various players who took part, in different but complementary ways, in the development and finalization of this research report. The following individuals are gratefully acknowledged: Editorial Panel • Dr Aceme Nyika (Chairperson; Director: Research and Innovation) • Professor Andries Bezuidenhout (Faculty of Management & Commerce) • Dr Lelethu Heshula (Faculty of Science and Agriculture) • Professor Maya van Gent (Faculty of Health Sciences) • Professor Philani Moyo (Director: Fort Hare Institute of Social and Economic Research) Professor Chris Boughey, Writer (Professor Emeritus, Centre for Postgraduate Studies, Rhodes University) Alida Mundell, Senior Graphic Designer (UFH Institutional Advancement) Tim Wilson, Photographer (UFH Institutional Advancement) Dr Octavia Sibanda, Administration and Coordination (Research Manager: Research and Innovation) Kanyisile Mandla, Administration (Research and Innovation Director’s Office) 79 | University of Fort Hare

Univ er sit y of F or t Har University of Fort Hare e | RESEARCH REPOR RESEARCH REPORT T 20 2021/2022 21/20 22 www.ufh.ac.za ufh1916 @ufh1916 @ufh1916 Towards a Decade of Renewal Research Report 2021/2022 | 81